The Journal of Experimental Medicine
BioLegend: New Th17, Treg Tools
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 157K)
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Degermann, S.
Right arrow Articles by Karjalainen, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Degermann, S.
Right arrow Articles by Karjalainen, K.
Right arrowPubmed/NCBI databases
*Gene
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
© The Rockefeller University Press, 0022-1007/1999/11/1357/ $5.00
The Journal of Experimental Medicine, Volume 190, Number 9, November 1, 1999 1357-1362


Brief Definitive Reports

Impaired NK1.1 T Cell Development in Mice Transgenic for a T Cell Receptor ß Chain Lacking the Large, Solvent-exposed Cß FG Loop

Sylvie Degermanna, Giuseppina Sollamia, and Klaus Karjalainena
a Basel Institute for Immunology, CH-4005 Basel, Switzerland

Correspondence to: Sylvie Degermann, Basel Institute for Immunology, Grenzacherstr. 487, CH-4005 Basel, Switzerland. Tel:41-61-605-1249 Fax:41-61-605-1364 E-mail:degermann{at}bii.ch.


   Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Acknowledgements
 References

A striking feature of the T cell receptor (TCR) ß chain structure is the large FG loop that protrudes freely into the solvent on the external face of the Cß domain. We have already shown that a transgene-encoded Vß8.2+ TCR ß chain lacking the complete Cß FG loop supports normal development and function of conventional {alpha}/ß T cells. Thus, the FG loop is not absolutely necessary for TCR signaling. However, further analysis has revealed that a small population of {alpha} T cells coexpressing NK1.1 are severely depleted in these transgenic mice. The few remaining NK1.1 T cells have a normal phenotype but express very low levels of TCR. We find that the TCR Vß8.2+ chain lacking the Cß FG loop cannot pair efficiently with the invariant V{alpha}14-J{alpha}281 TCR {alpha} chain commonly expressed by this T cell family. Consequently, fewer NK1.1 T cells develop in these mice. Our results suggest that expression of the V{alpha}14+ TCR {alpha} chain is particularly sensitive to TCR-ß conformation. Development of NK1.1 T cells appears to need a TCR-ß conformation dependent on the presence of the Cß loop that is not necessarily required for assembly and function of TCRs on most {alpha} T cells.

Key Words: TCR, Cß FG loop, mutagenesis, NK1.1 T cells, V{alpha}14


   Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Acknowledgements
 References

All crystal structures of the TCR ß chain reported to date have shown that the constant and variable domains are closely associated, with a large, solvent-exposed loop of 14 amino acids protruding on the external face of the Cß domain (1) (2) (3) (4). The location and size of this loop (almost half of an Ig domain) suggested that it could be the crucial link between TCR-{alpha}/ß recognition of antigen and transmission of signals by the invariant CD3 (1) (4) (5). To study its function, we recently generated mice transgenic for a TCR ß chain lacking the complete Cß FG loop. The TCR ß chain (Vß8.2-Jß2.1) chosen for mutagenesis has been crystallized (1); it was cloned from T cell hybridoma 14.3.d, which expresses a TCR {alpha} chain (V{alpha}4-J{alpha}47) and recognizes a PR8 influenza hemagglutinin peptide, HA 110–119, presented by the I-Ed MHC molecule (6). Surprisingly, we found that development and function of conventional {alpha}/ß T cells was normal in mice transgenic for a TCR ß chain lacking the Cß FG loop. Thus, the Cß FG loop is not absolutely required for transmitting the signal of antigen recognition by the TCR (7).

Further analysis revealed that a small population of {alpha} T cells coexpressing NK1.1 is drastically diminished in these mice. Many features (8), including development, functional properties, and TCR repertoire, distinguish this latter population from conventional T cells. Development of NK1.1 T cells requires expression of the ß2 microglobulin–associated, class Ib–like CD1d1 molecule (9) (10), which can restrict their response to lipid ligands such as glycosylphosphatidylinositols or glycosylceramides (11) (12). NK1.1 T cells can readily produce large amounts of cytokines upon activation (13), and they have been implicated in tumor rejection (14) (15) and may also play a regulatory role in autoimmune manifestations (16) (17) (18). NK1.1 T cells express a limited Vß repertoire highly skewed toward Vß8.2, Vß7, and Vß2 (8), and in transgenic mice expressing single Vßs such as Vß3 and Vß8.1, NK1.1 T cell development is totally abrogated (19). Furthermore, ~80% of NK1.1 T cells express an invariant TCR {alpha} chain (V{alpha}14-J{alpha}281) (20) (21) that is required for their development (15).

In this study, we present evidence that the Vß8.2 TCR ß chain lacking the complete Cß FG loop cannot pair efficiently with the canonical V{alpha}14+ TCR {alpha} chain. Consequently, NK1.1 T cell development is severely impaired.


   Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Acknowledgements
 References

TCR-ß Mutagenesis.
The wild-type TCR ß chain (Vß8.2-Jß2.1) cDNA was used as a template for mutagenesis. Deletion of the 14 nucleotides forming the Cß FG loop has been described (7). Transgenic vectors have also been described previously (22).

Transfection of Cell Lines.
Packaging cell lines GP+E-86 (23) were transfected with retroviral vector LXSN expressing the Vß8.2-Jß2.1+ TCR-ß or ß-loop- chain or LXSP expressing the V{alpha}4-J{alpha}47+ or V{alpha}14-J{alpha}281+ TCR {alpha} chain cDNA. The TCR {alpha} chain (V{alpha}14-J{alpha}281) was cloned from NK1.1 {alpha}+ T cell hybridoma total RNA provided by R. MacDonald (Ludwig Institute for Cancer Research, Lausanne, Switzerland). After appropriate selection of the packaging cells, the infectious supernatants were used to infect TCR- hybridomas (24) as previously described (25). The TCR-ß or ß-loop- chain was first introduced into the hybridomas and, after neomycin selection (G418; 1 mg/ml), these cells were superinfected with TCR {alpha} chain by culturing them on packaging lines producing LXSP TCR-{alpha} V{alpha}4-J{alpha}47 or V{alpha}14-J{alpha}281. The hybridomas were then maintained in IMDM supplemented with 2% FCS, neomycin, and puromycin (10 µg/ml). TCR expression was tested by FACSTM as early as 4 d after selection. Stable transfectants were maintained in G418 and puromycin-containing medium.

TCR Immunoprecipitation and Western Blot Analysis.
Hybridomas were lysed at 2 x 107 cells/ml in 1% Triton X-100 (Bio-Rad Labs.), 150 mM NaCl, 20 mM Tris/HCl, and 5 mM EDTA, pH 7.5, buffer containing complete protease inhibitors (Boehringer Mannheim) for 30 min at 4°C. Lysates cleared of cell debris were immunoprecipitated with purified mAb F23.1 (2 µg/ml) and protein G–Sepharose (Pharmacia). After washing with lysis buffer and PBS, the lyophilized pellets were resuspended in reducing SDS buffer, loaded on a 4–12% Bis-Tris precast gel (Novex), and transferred onto nitrocellulose membrane Hybond-C extra (Amersham). Blots were probed in PBS 6% blotting blocker nonfat milk (Bio-Rad Labs.) and 0.2% Tween with purified mAb H58 (anti-C{alpha}), followed by goat anti–hamster horseradish peroxidase–labeled mAb (Southern Biotechnology Associates, Inc.) or biotinylated F23.1 (anti-Vß8) mAb followed by streptavidin–horseradish peroxidase (Southern Biotechnology Associates, Inc.). The proteins were detected with a chemiluminescent detection system (Pierce Chemical Co.).

Mice.
BALB/c and C56BL/6 mice were purchased from IFFA-Credo. The TCR-ß knockout mice have been described (26) and were bred in our specific pathogen–free animal facility with the TCR-ß or TCR ß-loop- transgenic mice.

Cell Suspension, Flow Cytometry, and Antibodies.
Cell suspensions from thymi were depleted of CD8+ T cells with anti-CD8 31M antibody (27) and complement treatment (Cedarlane Labs.), and liver cells were simply ficolled to eliminate red cells before immunofluorescence stainings, performed as previously described (28). Flow cytometric analyses were performed on a FACSCaliburTM equipped with CELLQuest software (Becton Dickinson). The reagents used were mAbs 145-2C11 (anti-CD3{isin}), NKR-P1C (anti-NK1.1), H57-597 (anti-Cß), RM4-5 (anti-CD4), IM7 (anti-CD44, Pgp-1), TM-ß1 (anti–IL-2R ß chain), MEL-14 (anti-CD62L) (all seven mAbs purchased from PharMingen), biotinylated F23.1 (anti-Vß8.1,2,3), and second step reagent streptavidin–allophycocyanin (Molecular Probes, Inc.).

Single-Cell Reverse Transcriptase–PCR.
Single NK1.1+CD3+ cells were sorted into polycarbonated 96-well plates (one cell per well in 5 µl of PBS) and immediately frozen on dry ice and stored at -70°C. To prepare cDNA, the plate was heated up to 65°C for 1 min before adding into each well 10 µl of the reverse transcriptase (RT)-PCR mix (reverse transcriptase Superscript II; GIBCO BRL) for 1 h at 42°C under standard reaction conditions. After heat inactivation of the enzyme (2 min at 95°C), DNA amplification was carried out as described (29). 75 µl of a PCR mix containing Taq polymerase and the primers necessary for DNA amplification of the V{alpha}14+ TCR {alpha} chain (5' V{alpha}14 CTAAGCACAGCACGCTGCACA [reference 20]; 3' C{alpha} ATGGATCCTCAACTGGACCACAGCCTCA) and Vß8.2+ TCR ß chain (5' Vß8.2 CTTGAGCTCAAGATGGGCTCCAGGCTCTTC; 3' Jß2.1 CTGCTCAGCATAACTCCCCCG) were added to the wells for the first round of PCR (30 cycles). An aliquot from this PCR (1 µl) was used for a second round of PCR (35 cycles) to individually reamplify the V{alpha}14+ TCR {alpha} chain or Vß8.2+ TCR ß chain using the same specific primers.


   Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Acknowledgements
 References

To avoid any influence of the endogenous ß locus on the expression of the mutated ß chain, mice transgenic for the Vß8.2+ TCR ß chain lacking the Cß FG loop (ß-loop-) were backcrossed to TCR-ß-/- mice (26). T cell development in these mice was compared with that in wild-type Vß8.2+ TCR ß chain transgenic mice, also with a ß-/- background. As described in our previous study (7), peripheral T cells from mice transgenic for the TCR ß or ß-loop- chain express equal levels of the TCR–CD3 complex, and whereas the anti-Vß8 F23.1 mAb recognizes all T cells, the Cß-specific H57 mAb does not stain cells expressing the TCR ß-loop- chain (Figure 1; reference 4). It is worth pointing out that in the absence of the Cß FG loop, the anti-CD3{isin} 2C11 mAb stains better, suggesting that the epitope recognized is more accessible, a result that might not be surprising, as one of the CD3{isin} chains is physically adjacent to the ß chain in the TCR–CD3 complex (5).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 1. T cells expressing the Vß8.2+ TCR ß chain lacking the FG loop cannot be stained with the Cß-specific H57 mAb. LN cell suspensions from TCR-ß and ß-loop- transgenic mice were stained with anti-CD3 together with anti-Vß8 or anti-Cß mAb.

We consistently found that TCR ß-loop- transgenic mice have significantly fewer NK1.1 {alpha}+ T cells in the thymus, liver, and spleen (data not shown) in comparison to TCR-ß transgenic mice or wild-type littermates (Figure 2). Thus, a mutation in the Cß domain can notably alter development of NK1.1 {alpha}/ß T cells. This result was puzzling, considering that conventional {alpha}/ß T cells are normal in TCR ß-loop- transgenic mice (7). Furthermore, the mutated TCR ß chain uses Vß8.2, a variable region that is usually expressed by >40% of NK1.1 {alpha}/ß T cells (30). Hence, monoclonal expression of the wild-type Vß8.2+ TCR ß chain allows NK1.1 T cell development comparable to that of nontransgenic littermates. Characteristically, NK1.1 T cells express intermediate levels of TCR (8). Interestingly, in TCR ß-loop- transgenic mice, TCR expression on the few remaining NK1.1 T cells is even lower than in control animals; these cells express about four times less TCR than do those in wild-type ß-transgenic mice (Figure 3). Otherwise, NK1.1 T cells in ß-loop- transgenic mice express normal levels of CD4 and are CD44+CD62 ligand (L)- and IL-2Rß+, as expected for this T cell population (8). CD1d, a ß2 microglobulin–associated molecule required for NK1.1 T cell development (9) (10), is also expressed at normal levels in TCR ß-loop- transgenic mice (data not shown).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 2. Decreased amount of NK1.1 T cells in TCR ß-loop- transgenic mice. Cell suspension from thymi previously depleted of CD8+ cells and livers from nontransgenic littermates (WT) or TCR-ß or ß-loop- transgenic mice were double stained with anti-NK1.1 together with anti-Cß (to stain all T cells in WT mice) or anti-Vß8 (which stains all T cells in transgenic mice) antibodies. Numbers express the percentages of total adjacent gated dots.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 3. The remaining NK1.1 T cells in TCR ß-loop- transgenic mice have a normal phenotype. Liver cell suspensions from TCR-ß or ß-loop- transgenic mice were triple stained with anti-NK1.1, anti-Vß8, and either anti-CD4 or anti-CD44 or anti-CD62L or anti–IL-2Rß mAbs. Histograms represent NK1.1+Vß8+ gated events. Numbers in parentheses represent the mean fluorescence intensity of Vß8 staining. Negative controls of Vß8 staining are shown (dashed lines).

To determine if development of NK1.1 {alpha}+ T cells could be rescued by the expression of endogenous ß chains, as has been described for other TCR-ß transgenic mice (19), we studied NK1.1 T cell frequency in TCR ß-loop- transgenic mice on a ß+/- background. We have already observed that in these mice, inhibition of ß rearrangements via allelic exclusion is not total, and ~10–20% of peripheral T cells can express endogenous ß chains (data not shown). NK1.1 {alpha}+ T cells expressing endogenous ß and ß-loop- chains could be distinguished by the Cß-specific H57 mAb, which cannot stain T cells expressing the mutated ß chain (Figure 1). As shown in Figure 4, expression of endogenous ß chains can rescue NK1.1 T cell development to a certain extent. NK1.1 Cß+ cells appear in the livers of TCR ß-loop- transgenic mice on a ß+/- background. Yet these cells only account for about one-third of the whole NK1.1 T cell population. The NK1.1 Cß- T cells are still predominant. There are two populations of NK1.1 Vß8+ cells, which express either intermediate or low TCR levels in TCR ß-loop- transgenic mice on a ß1/- background. Interestingly, expression of endogenous ß chains accounts for most of the NK1.1 T cells expressing intermediate TCR levels. Thus, expression of endogenous ß chains did rescue some NK1.1 T cell development and restore TCR expression to intermediate levels. This result strongly suggested that the Cß FG loop is needed for efficient TCR assembly in NK1.1 T cells.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 4. Expression of endogenous TCR ß chains can rescue some NK1.1 T cell development. Liver cell suspensions from TCR ß, ß-loop- transgenic with a ß-/- background (ß-loop- ß-endo-/-) or ß-/+ background (ß-loop- ß-endo-/+) were triple stained with anti-NK1.1, anti-Cß, and anti-Vß8 mAbs. Numbers in dot plots are percentages of the total adjacent gated dots. Histograms represent expression of Cß (in ß-loop- transgenic mice with a ß-/- or ß-/+ background) for the NK1.1+ gated population expressing either intermediate (NK1.1+Vß8int) or low levels of TCR (NK1.1+Vß8low).

As most NK1.1 {alpha}+ T cells express an invariant V{alpha}14-J{alpha}281 TCR {alpha} chain (20) (21), and the mutant TCR ß chain is expressed at normal levels by conventional {alpha}/ß T cells (Figure 1) but not by NK1.1 T cells (Figure 3), we assessed whether the mutant Vß8.2+ TCR ß chain could still pair with the V{alpha}14+ TCR {alpha} chain. TCR- hybridomas were transfected with cDNAs coding for either the wild-type TCR ß or ß-loop- chain together with the V{alpha}14+ TCR {alpha} chain or V{alpha}4+ TCR {alpha} chain (the original partner of the nonmutated ß chain) cDNAs. As shown in Figure 5 A, the TCR ß-loop- chain clearly pairs with and is expressed on the cell surface with the V{alpha}4+ TCR {alpha} chain but is barely detectable on the cell surface with the V{alpha}14+ TCR {alpha} chain. In contrast, the wild-type TCR ß chain is expressed on the cell surface with both {alpha} chains (Figure 5). However, the V{alpha}14+ TCR is expressed at lower levels than is the V{alpha}4+ TCR. This observation may reflect the in vivo situation in which a TCR on NK1.1 T cells is expressed at lower levels than on conventional {alpha}/ß T cells. To assess whether impaired cell surface expression of the TCR wild-type ß and ß-loop- chain together with the V{alpha}14+ TCR {alpha} chain is due to a problem of pairing, TCRs from the transfectants were immunoprecipitated with anti-Vß8 mAb. As can be seen in Figure 5 B, the TCR {alpha} chain can be coimmunoprecipitated with the TCR ß chain in all transfectants expressing the TCR on the cell surface. In contrast, the V{alpha}14+ TCR {alpha} chain cannot be coimmunoprecipitated with the mutant ß chain in detectable amounts. This result implies that the V{alpha}14+ TCR {alpha} chain pairs very poorly with the Vß8+ TCR ß chain lacking the Cß FG loop. It is worth pointing out that in the hybridomas producing the wild-type ß and V{alpha}14+ chains, many fewer assembled {alpha}/ß dimers can be immunoprecipitated compared with control Vß8.2/V{alpha}4 dimers. This latter result suggests that mere physical constraints on the assembly of the ß chain with the V{alpha}14+ TCR {alpha} chain exist and is consistent with the low TCR expression on normal NK1.1 T cells.




View larger version (66K):
[in this window]
[in a new window]
 
Figure 5. Inefficient pairing of the V{alpha}14+ TCR {alpha} chain with the Vß8.2+ TCR ß chain lacking the complete Cß FG loop. (A) TCR- hybridomas were transfected with either the Vß8.2+ wild-type TCR ß or ß-loop- chain, together with the V{alpha}14+ TCR {alpha} chain or V{alpha}4+ TCR {alpha} chain. Stable transfectants were stained with biotinylated anti-CD3 mAb, followed by streptavidin–allophycocyanin. Stainings of cells transfected with only the TCR ß or ß-loop- chain are shown as controls. Numbers in parentheses represent the mean fluorescence intensities of CD3 staining. (B) TCRs of transfected hybridomas or Vß8+ T hybridoma control (A5) (8.0, 8.0, 10.0, 14.0, 20.0, 20.0, and 8.0 x 107 cells per lane, respectively, from left to right) were immunoprecipitated with anti-Vß8 mAb (F23.1), electrophoresed on a 4–12% gel in reducing conditions, and blotted with anti-C{alpha} (H58) or anti-Vß8 mAb as described in Materials and Methods. Numbers represent protein molecular mass (kD).

Next, we assessed whether the NK1.1 {alpha}+ T cells that do develop in TCR ß-loop- transgenic mice express the V{alpha}14+ TCR {alpha} chain by performing RT-PCR on single NK1.1 CD3+ T cells sorted from TCR-ß and ß-loop- transgenic mice. As summarized in Table 1, the frequency of NK1.1 T cells expressing V{alpha}14 is not significantly decreased in TCR ß-loop- transgenic mice in comparison to wild-type TCR-ß transgenic animals. One has to keep in mind, however, that there are few NK1.1 T cells in the mutant mice, and these express much lower levels of TCR (Figure 3). This, together with biochemical data, strongly suggests that in TCR ß-loop- transgenic mice, both the impaired development of NK1.1 T cells and their weak TCR expression is due to the physical constraints on the assembly of the ß chain lacking the Cß FG loop with the V{alpha}14+ TCR {alpha} chain.


 
View this table:
[in this window]
[in a new window]
 
Table 1. Expression of the V{alpha}14+ TCR {alpha} Chain by the Remaining NK1.1 T Cells in TCR ß-loop- Transgenic Mice

We have previously shown that in conventional T cells expressing Vß8.2, deletion of the Cß FG loop has no effect on V{alpha} (7) and J{alpha} repertoire usage (our unpublished data). This result suggested that no drastic conformational changes in the TCR ß chain were created by the mutation. However, in this study we clearly show that expression of the V{alpha}14+ {alpha} chain is sensitive to deletion of the Cß FG loop. Therefore, deletion of the Cß FG loop must create some subtle change in TCR ß chain conformation. It seems that expression of the V{alpha}14+ {alpha} chain does not allow much structural flexibility of the TCR, as it is particularly sensitive to TCR ß chain conformation. Its expression might impose stringent constraints on {alpha}/ß assembly. This could at least partially explain why the Vß repertoire of NK1.1 T cells is relatively limited (30). Pairing with the apparently conformation-sensitive V{alpha}14-J{alpha}281 TCR {alpha} chain could be the initial pressure on Vß usage in NK1.1 T cells (19). Recently, results obtained by using V{alpha}14-transgenic mice suggested that selection was the main force in shaping the NK1.1 T cell repertoire (31). Here we have shown that in addition to selection, differential V{alpha}–Vß pairing can also potentially influence the NK1.1 T cell diversity. In summary, our data show that subtle changes in the TCR ß chain conformation (which do not seem to affect conventional Vß8.2+ {alpha}/ß TCRs) can substantially alter pairing with the V{alpha}14+ {alpha} chain and impair NK1.1 T cell development.


   Acknowledgements
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Acknowledgements
 References

We thank R. MacDonald for providing total RNA from NK1.1 {alpha}+ T cell hybridoma. We are grateful to Susan Gilfillan and Ed Palmer for critical reading of the manuscript.

The Basel Institute for Immunology was founded and is supported by F. Hoffmann-La Roche Ltd., Basel, Switzerland.

Submitted: 22 April 1999
Revised: 25 August 1999
Accepted: 26 August 1999


   References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Acknowledgements
 References

  1. Bentley, G., Boulot, G., Karjalainen, K., Mariuzza, R. 1995. Crystal structure of the ß chain of a T cell antigen receptor. Science. 267:1984-1987[Abstract/Free Full Text].

  2. Garcia, K., Degano, M., Stanfield, R., Brunmark, A., Jackson, M., Peterson, P., Teyton, L., Wilson, I. 1996. An {alpha}/ß T cell receptor structure at 2.5 Å and its orientation in the TCR-MHC complex. Science. 274:209-219[Abstract/Free Full Text].

  3. Garboczi, D., Ghosh, P., Utz, U., Fan, Q., Biddison, W., Wiley, D. 1996. Structure of the complex between human T-cell receptor, viral peptide and HLA-A2. Nature. 384:134-141[Medline].

  4. Wang, J., Lim, K., Smolyar, A., Teng, M., Liu, J., Tse, A., Hussey, R., Chishti, Y., Thomson, C., Sweet, R. et al. 1998. Atomic structure of an {alpha}/ß T cell receptor (TCR) heterodimer in complex with an anti-TCR fab fragment derived from a mitogenic antibody. EMBO (Eur. Mol. Biol. Organ.) J. 17:10-26[Medline].

  5. Ghendler, Y., Smolyar, A., Chang, H., Reinherz, E. 1998. One of the CD3{isin} subunits within a T cell receptor complex lies in close proximity to the Cß FG loop. J. Exp. Med. 187:1529-1536[Abstract/Free Full Text].

  6. Weber, S., Traunecker, A., Oliveri, F., Gerhard, W., Karjalainen, K. 1992. Specific low-affinity recognition of major histocompatibility complex plus peptide by soluble T-cell receptor. Nature. 356:793-796[Medline].

  7. Degermann, S., Sollami, G., Karjalainen, K. 1999. T cell receptor ß chain lacking the large solvent-exposed Cß FG loop supports normal {alpha}/ß T cell development and function in transgenic mice. J. Exp. Med. 189:1679-1683[Abstract/Free Full Text].

  8. Bendelac, A., Rivera, M., Park, S., Roark, J. 1997. Mouse CD1-specific NK1 T cells: development, specificity, and function. Annu. Rev. Immunol. 15:535-562[Medline].

  9. Mendiratta, S., Martin, W., Hong, S., Boesteanu, A., Joyce, S., Van, K.L. 1997. CD1d1 mutant mice are deficient in natural T cells that promptly produce IL-4. Immunity. 6:469-477[Medline].

  10. Chen, Y., Chiu, N., Mandal, M., Wang, N., Wang, C. 1997. Impaired NK1+ T cell development and early IL-4 production in CD1-deficient mice. Immunity. 6:459-467[Medline].

  11. Joyce, S., Woods, A., Yewdell, J., Bennink, J., De, S.A., Boesteanu, A., Balk, S., Cotter, R., Brutkiewicz, R. 1998. Natural ligand of mouse CD1d1: cellular glycosylphosphatidylinositol. Science. 279:1541-1544[Abstract/Free Full Text].

  12. Kawano, T., Cui, J., Koezuka, Y., Toura, I., Kaneko, Y., Motoki, K., Ueno, H., Nakagawa, R., Sato, H., Kondo, E. et al. 1997. CD1d-restricted and TCR-mediated activation of V{alpha}14 NKT cells by glycosylceramides. Science. 278:1626-1629[Abstract/Free Full Text].

  13. Chen, H., Paul, W. 1997. Cultured NK1.1+CD4+ T cells produce large amounts of IL-4 and IFN-{gamma} upon activation by anti-CD3 or CD1. J. Immunol. 159:2240-2249[Abstract/Free Full Text].

  14. Takeda, K., Seki, S., Ogasawara, K., Anzai, R., Hashimoto, W., Sugiura, K., Takahashi, M., Satoh, M., Kumagai, K. 1996. Liver NK1.1+CD4+ {alpha}/ß T cells activated by IL-12 as a major effector in inhibition of experimental tumor metastasis. J. Immunol. 156:3366-3375[Abstract].

  15. Cui, J., Shin, T., Kawano, T., Sato, H., Kondo, E., Toura, I., Kaneko, Y., Koseki, H., Kanno, M., Taniguchi, M. 1997. Requirement for V{alpha}14 NKT cells in IL-12-mediated rejection of tumors. Science. 278:1623-1626[Abstract/Free Full Text].

  16. Mieza, M., Itoh, T., Cui, J., Makino, Y., Kawano, T., Tsuchida, K., Koike, T., Shirai, T., Yagita, H., Matsuzawa, A. et al. 1996. Selective reduction of V{alpha}14 NKT cells associated with disease development in autoimmune-prone mice. J. Immunol. 156:4035-4044[Abstract].

  17. Hammond, K., Poulton, L., Palmisano, L., Silveira, P., Godfrey, D., Baxter, A. 1998. {alpha}/ß–T cell receptor (TCR)+ CD4-CD8- (NKT) thymocytes prevent insulin-dependent diabetes mellitus in nonobese diabetic (NOD)/Lt mice by the influence of interleukin (IL)-4 and/or IL-10. J. Exp. Med. 187:1047-1055[Abstract/Free Full Text].

  18. Wilson, S., Kent, S., Patton, K., Orban, T., Jackson, R., Exley, M., Porcelli, S., Schatz, D., Atkinson, M., Balk, S. et al. 1998. Extreme Th1 bias of invariant V{alpha}24J{alpha}Q T cells in type 1 diabetes. Science. 391:177-181.

  19. Ohteki, T., MacDonald, H. 1996. Stringent Vß requirement for the development of NK1.1+ T cell receptor-{alpha}1 cells in mouse liver. J. Exp. Med. 183:1277-1282[Abstract/Free Full Text].

  20. Lantz, O., Bendelac, A. 1994. An invariant T cell receptor {alpha} chain is used by a unique subset of major histocompatibility complex class I–specific CD4+ and CD4-8- T cells in mice and humans. J. Exp. Med. 180:1097-1106[Abstract/Free Full Text].

  21. Shimamura, M., Ohteki, T., Beutner, U., MacDonald, H. 1997. Lack of directed V{alpha}14-J{alpha}281 rearrangements in NK1+ T cells. Eur. J. Immunol. 27:1576-1579[Medline].

  22. Kirberg, J., Baron, A., Jakob, S., Rolink, A., Karjalainen, K., von Boehmer, H. 1994. Thymic selection of CD8+ single positive cells with a class II major histocompatibility complex–restricted receptor. J. Exp. Med. 180:25-34[Abstract/Free Full Text].

  23. Markowitz, D., Goff, S., Bank, A. 1988. A safe packaging line for gene transfer: separating viral genes on two different plasmids. J. Virol. 62:1120-1124[Abstract/Free Full Text].

  24. Letourneur, F., Malissen, B. 1989. Derivation of a T cell hybridoma variant deprived of functional T cell receptor alpha and beta chain transcripts reveals a nonfunctional alpha-mRNA of BW5147 origin. Eur. J. Immunol. 19:2269-2274[Medline].

  25. Backstrom, B., Milia, E., Peter, A., Jaureguiberry, B., Baldari, C., Palmer, E. 1996. A motif within the T cell receptor {alpha} chain constant region connecting peptide domain controls antigen responsiveness. Immunity. 5:437-447[Medline].

  26. Mombaerts, P., Clarke, A., Rudnicki, M., Iacomini, J., Itohara, S., Lafaille, J., Wang, L., Ichikawa, Y., Jaenisch, R., Hooper, M. et al. 1992. Mutations in T-cell antigen receptor genes {alpha} and ß block thymocyte development at different stages. Nature. 360:225-231[Medline].

  27. Sarmiento, M., Dialynas, D.P., Lancki, D.W., Wall, K.A., Lorber, M.I., Loken, M.R., Fitch, F.W. 1982. Cloned T lymphocytes and monoclonal antibodies as probes for cell surface molecules active in T cell-mediated cytolysis. Immunol. Rev. 68:135-169[Medline].

  28. Degermann, S., Surh, C., Glimcher, L., Sprent, J., Lo, D. 1994. B7 expression on thymic medullary epithelium correlates with epithelium-mediated deletion of Vß51 thymocytes. J. Immunol. 152:3254-3263[Abstract].

  29. Ten Boekel, E., Melchers, F., Rolink, A. 1995. The status of Ig rearrangements in single cells from different stages of B cell development. Int. Immunol. 7:1013-1019[Abstract/Free Full Text].

  30. Arase, H., Arase, N., Ogasawara, K., Good, R., Onoe, K. 1992. An NK1.1+ CD4+CD8- single-positive thymocyte subpopulation that expresses a highly skewed T-cell antigen receptor Vß family. Proc. Natl. Acad. Sci. USA. 89:6506-6510[Abstract/Free Full Text].

  31. Bendelac, A., Hunziker, R., Lantz, O. 1996. Increased interleukin 4 and immunoglobulin E production in transgenic mice overexpressing NK1 T cells. J. Exp. Med. 184:1285-1293[Abstract/Free Full Text].


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 157K)
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Degermann, S.
Right arrow Articles by Karjalainen, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Degermann, S.
Right arrow Articles by Karjalainen, K.
Right arrowPubmed/NCBI databases
*Gene
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


  Home | Help | Feedback | Subscriptions | Archive | Search
TABLE OF CONTENTS