|
||
3 Domain
with the Transporter Associated with Antigen Processing
By

ík,§
*
From the * Michael Heidelberger Division of Immunology, the Department of Pathology and Kaplan
Comprehensive Cancer Center, New York University Medical Center, New York 10016; the
Department of Biochemistry, Indian Institute of Science, Bangalore, India 560012; § Laboratory of
Viral Diseases, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland 20892; and
the ¶ Department of Molecular Genetics, Howard Hughes Medical Institute, University of Cincinnati,
Cincinnati, Ohio 45267
| |
Abstract |
|---|
|
|
|---|
CD8+ T lymphocytes recognize antigens as short, MHC class I-associated peptides derived by
processing of cytoplasmic proteins. The transporter associated with antigen processing translocates peptides from the cytosol into the ER lumen, where they bind to the nascent class I molecules. To date, the precise location of the class I-TAP interaction site remains unclear. We
provide evidence that this site is contained within the heavy chain
3 domain. Substitution of
a 15 amino acid portion of the H-2Db
3 domain (aa 219-233) with the analogous MHC class
II (H-2IAd)
2 domain region (aa 133-147) results in loss of surface expression which can be
partially restored upon incubation at 26°C in the presence of excess peptide and
2-microglobulin. Mutant H-2Db (Db219-233) associates poorly with the TAP complex, and cannot present endogenously-derived antigenic peptides requiring TAP-dependent translocation to the ER.
However, this presentation defect can be overcome through use of an ER targeting sequence
which bypasses TAP-dependent peptide translocation. Thus, the
3 domain serves as an important site of interaction (directly or indirectly) with the TAP complex and is necessary for
TAP-dependent peptide loading and class I surface expression.
| |
Introduction |
|---|
|
|
|---|
The MHC class I molecule is a heterotrimeric complex
comprised of a 44-kD heavy chain,
2-microglobulin
(
2m; 12-kD light chain),1 and a peptide of 8-10 residues
(1). This complex is recognized by CD8+ T cells when
displayed on the surface of cells. Assembly of class I molecules occurs in the endoplasmic reticulum (ER) when the newly synthesized heavy chain associates with resident ER
chaperone calnexin, which facilitates folding and disulfide
bridge formation of the heavy chain and promotes its binding to
2m (5, 6). Class I-
2m dimers then associate with a
heterodimeric, ER membrane protein called TAP (for
transporter associated with antigen processing), which consists of TAP1 and TAP2. TAP transports peptides which are predominantly derived from cytosolic proteins into the
ER lumen in an ATP-dependent manner (7, 8).
Physical association of class I heavy chain-
2m dimers
with TAP as determined by coprecipitation studies (9)
suggests a specific role of TAP in delivering peptides directly to the MHC class I. It is not clear at present whether
TAP associates with MHC class I directly or via an adaptor
molecule. A recently described protein, tapasin, is required
for class I interaction with TAP (13) and has more recently been shown to be necessary for
2m association
with TAP (18). Thus, tapasin can be described as a molecular bridge between class I and TAP molecules. Studies on
the role of tapasin have been carried out using human cell lines and although tapasin seems to be required for proper
class I assembly and subsequent expression in these cell
lines, a murine counterpart for tapasin remains to be identified.
Peptide loading of MHC class I can also occur in a TAP-independent manner, as evidenced by the surface expression on TAP-deficient cells of class I molecules that are loaded with signal sequence-derived peptides (19, 20). However, this TAP-independent peptide loading seems to be a minor pathway as it is relevant for a limited set of MHC class I alleles that can bind signal sequence peptides, and the diversity of the bound peptides is very limited (19, 20). Once localized to the ER lumen, peptides can bind to and thereby stabilize nascent class I molecules. Peptide binding results in the release of the class I molecule from the ER (9, 10) and subsequent transport to the cell surface via the exocytic pathway. The majority of misfolded, incompletely assembled, or empty class I molecules are retained in the ER from where they are removed to the cytosol and degraded by the proteasome (21).
Thus, association of class I heavy chain-
2m with the
TAP complex (TAP1, TAP2, and possibly tapasin) appears
to be a critical event in MHC class I assembly. The location
of the site of interaction on class I with TAP complex remains uncertain. Both the extracellular (22) and the transmembrane region/cytoplasmic tail (23) have been implicated in this interaction. Point mutations introduced in the
3 domains of both H-2Ld and H-2Dd resulted in the loss
of TAP coprecipitation with the class I heavy chain (11,
22). However, these same point mutations do not affect the
ability of these molecules to be expressed at the cell surface
(24) and to present endogenous peptides (26), in contrast to mutations in either TAP or
2m that drastically affect both cell surface expression and antigen presentation of MHC class I (27). Evidence is presented here that physical association with the TAP complex, TAP-dependent
peptide loading, and cell surface expression of class I is
completely abolished by a 15-amino acid substitution made
in the H-2Db
3 domain. Thus, this region could define an
interaction site on the murine class I heavy chain with the
TAP complex.
| |
Materials and Methods |
|---|
|
|
|---|
Generation of Chimeric H-2Db Constructs.
PCR overlap extension was used to create H-2Db cDNA with substitutions in the
3 domain. For the 62-amino acid replacement mutant, class I
3 domain base pairs 666-849 (cDNA) were replaced with class
II
2 domain base pairs 2830-3013 (genomic DNA). The latter
fragment was obtained using the genomic H-2IA
d as template
and the following primers: sense = 5'-GAGAGATCTAACCACCACAAC-3', antisense = 5'-GGTACACACGGCATGTGTAGACCTCTCCCTG-3'. The product of this amplification
and the H-2Db cDNA were used as templates in a subsequent reaction where the H-2IA
d sequence was sewn to the base pairs
850-1097 portion of the H-2Db using the same sense primer as
above and 5'-GGATCCACGCTTTACA-3' as a reverse primer.
For the 15-amino acid replacement mutant, class I
3 domain
base pairs 736-780 were replaced with class II
2 domain base
pairs 2900-2944 using H-2Db cDNA as template. The base pairs
751-1097 mutant portion of the gene was generated with the
sense = 5'-TCATCCACACAGCTTAGGCCTGCAGGGGAT-3', and antisense = 5'-GGATCCACGCTTTACA-3'. The amplification product was extended using sense 5'-GAGACAGTGGGGGTCTCATCCACACAGCTT-3' and the same antisense
primer to obtain the 736-1097 base pair gene fragment. The 1-750
mutant fragment was obtained using sense 5'-GGATCCCAGATGGGG-3' and antisense 5'-GACCCCCACTGTCTCCTCCTGGCCATTCCTCTGCCAGGTCAGGGT-3' primers. The
1-750 and 736-1097 base pair fragments were then sewn using
sense = 5'-GGATCCCAGATGGGG-3' and antisense = 5'-GGATCCACGCTTTACA-3' primers.
PCR products were inserted into the pGEM vector (Promega,
Madison, WI) from which they were sequenced using the following primers: sense = 5'-ACCGAGGTGTCTATGGACTTCTTGCCC-3', antisense = 5'-AAAAGCCACCACAGCTCCAATGATGGC-3'. The BglII, SacI fragment of pGEM (now
containing cDNA for mutant H-2Db) was used to replace the
BglII, SacI fragment from the wild-type (wt)H-2Db cDNA contained in the Bluescript vector. The NotI, SacI fragment from
Bluescript-mutant H-2Db then replaced the corresponding portion of the wtDb in the pCMU-Db plasmid (31). The BamHI-digested 1.1-kb fragment from pCMU-Db was then inserted in
the appropriate orientation into the BamHI cloning site of the
pH
APr-I-neo expression vector and transfected into P815 cells
by electroporation as described previously for the wtH-2Db (32).
Reverse Transcription PCR.
Total RNA was isolated from 5 × 106 cells using TRIzol reagent (GIBCO BRL, Gaithersburg, MD) following the manufacturer's protocol. cDNA was synthesized using the Superscript preamplification system for first-strand cDNA synthesis (GIBCO BRL). PCR was carried out using Taq polymerase (Fisher Scientific, Fairlawn, NJ) and 20 µg/ml of each primer. Amplification was conducted for 30 cycles. Each cycle consisted of 60 s at 94°C, 60 s at 60°C, and 90 s at 72°C. The following primers were used: for
-actin, sense = 5'-GTGGGCGCCCCAGGCACCA-3', antisense = 5'-CTCCTTATTGTCACGCACGATTTC-3'; for H-2Db, sense = 5'-TACCTGCAGTTCGCCTATGAA-3', antisense = 5'-TGATGGCCATAGCTCCAAGGA-3' (PCR products were sequenced using these
same primers); for neomycin, sense = 5'-GCGGCGGCTGCATAC-3', antisense = 5'-TCATAGAAGGCGGCGG-3'. One
fifth of each PCR sample was loaded onto a 0.8% agarose gel and
visualized by ethidium bromide staining.
Cell Lines.
P815 transfectants were maintained in RPMI 1640/10% FCS (RP10) supplemented with 500 µg/ml Geneticin (GIBCO BRL). The influenza A/PR8/34 nucleoprotein (NP) peptide 366-374-specific CTL line, PR8.2 (29) was maintained by weekly restimulations with irradiated C57/BL6 spleen cells pulsed with 10 µM influenza NP peptide (ASNENMETM) in RP10 containing 5% rat Con A supernatant. To generate CTLs specific for endogenous influenza peptide, C57BL/6 mice were immunized with influenza strain A/PR8/34 (a gift from Dr. A. Garcia-Sastre, Mt. Sinai Medical Center, New York) by intraperitoneal injection and spleens were harvested after 10 d and stimulated in vitro for 5-6 d with virus-infected, autologous splenocytes. These CTLs were used in cytotoxicity assays using recombinant vaccinia constructs.Cytotoxicity Assays.
Target cells were pulsed with [51Cr]sodium chromate in RP10 medium for 1 h at 37°C, washed twice with PBS, and plated at 104 cells/well of a 96-well round-bottomed plate. Influenza NP 366-374 peptide as well as effector cells (CTLs) were then added to the wells to a final volume of 200 µl/well. After a 4-h incubation at 37°C, 100 µl of the supernatants were harvested and 51Cr-release was measured. Where flu peptide concentrations range from 1 nM to 10 µM, the effector to target ratio was kept constant at 10:1. For induction of class I expression, P815 transfectants (targets) were incubated overnight at 26°C in serum-free medium (Opti MEM I; GIBCO BRL) in the presence of 10 µM NP 366-374 peptide with or without human
2m (Sigma Chemical Co., St.
Louis, MO) at 5 µg/ml. Cells were then pulsed with 51Cr,
washed three times with PBS, and plated at 104/well. CTL assays
were carried out as above with effector to target ratios starting at
100:1 with serial, threefold dilutions of effector cells.
Flow Cytometry.
2-5 × 105 P815 and P815 transfectants were washed once in PBS/2% FCS followed by incubation with a saturating amount of biotinylated anti-H-2Db antibody (KH95; PharMingen, San Diego, CA) for 30 min at 4°C. Cells were washed twice with PBS/2% FCS and then suspended in 100 µl of a 1:100 dilution of streptavidin-PE (Caltag Labs., South San Francisco, CA). Cells were washed twice and resuspended in 300 µl PBS/1% formaldehyde. All samples were analyzed using a FACScan® flow cytometer (Becton Dickinson, Mountain View, CA).Generation of Vaccinia Constructs.
To produce the NP 366-374 recombinant vaccinia virus (VV), complementary oligonucleotides were designed and synthesized to insert into a modified pSC11 plasmid (33). The plus strand (+) was composed of the following bases: TCGACCACCATGGCTTCCAATGAAAATATGGAGACTATGTGATAGGTACCGC. This sequence encoded an insertional SalI site extension (TCGA), Kozak's sequence (CCACC), a methionine initiation triplet (ATG), nine triplet bases coding for the desired antigenic determinant (ASNENMETM), two stop codons (TGA and TAG), and an insertional NotI site (GC). The complementary minus strand (
) was composed of the following bases: GGCCGCGGTACCTATCACATAGTCTCCATATTTTCATTGGAAGCCATGGTGG. The
plus and minus strand oligonucleotides were annealed to create double-stranded DNA with SalI and NotI cloning sites and inserted into the modified version of pSC11 downstream of the
early/late VV p7.5 promoter.
The E3/19K leader/signal sequence (ES) NP 366-374 recombinant vaccinia virus was constructed by inserting synthetic oligonucleotides (StyI-NotI double-stranded DNA fragment) behind
the ES cloned into pSC11 (33, 34). All oligonucleotide insertions
into the pSC11 plasmids were confirmed by DNA sequencing.
Finally, recombinant vaccinia viruses were generated in CV-1
cells by homologous recombination, plaque-purified at least three
times, and propogated in thymidine kinase-deficient human 143B
osteosarcoma cells as described (35).
Immunoprecipitations.
Metabolic labeling, immunoprecipitation, and 2D nonequilibrium pH-gradient gel electrophoresis (NEPHGE)-PAGE were performed in essence as previously described (36, 37), except that 1% digitonin was used instead of 0.5% NP-40. Antibodies used for precipitation were obtained as follows: the anticalnexin antiserum was purchased from Stressgen (Victoria, Canada), the anti-heavy chain serum (38) was obtained from H. Ploegh (Massachusetts Institute of Technology, Boston, MA), and anti-TAP antisera were produced by immunizing rabbits with purified recombinant mouse TAP1 or TAP2-GST fusion proteins, and will be described in detail elsewhere (Nandi, D., and J.J. Monaco, manuscript in preparation).| |
Results |
|---|
|
|
|---|
Sequences from the
2 domain of
the mouse MHC class II H-2IA
d gene were substituted
into the
3 domain of the class I H-2Db gene using a PCR
overlap extension mutagenesis strategy. The class II
2 domain was chosen to substitute for the class I
3 domain due
to its predicted structural homology to the
3 domain (39).
Two such chimeric H-2Db constructs were created, one
with an exchange of 15 amino acids and the other with a
62-amino acid replacement (Fig. 1 A). Due to sequence
homology between these class I and II domains, the actual
change in the number of amino acids is 11 and 42, respectively. However, we will refer to these molecules as 15-
(Db219-233) and 62- (Db196-257) amino acid replacements in keeping with the total number of class II residues
introduced.
|
The 15- and 62-amino acid mutant constructs as well as a wtH-2Db construct were transfected into the P815 murine mastocytoma cell line (H-2d) and screened for expression of the mutant molecules at the messenger RNA level using reverse transcription PCR. RNA was isolated and cDNA synthesized from each of the 15- and 62-amino acid mutant P815 transfectants (designated P815-Db219- 233 and P815-Db196-257, respectively) as well as from nontransfected P815 and wtDb P815 transfectants. The cDNA was amplified in a PCR using primers specific for the H-2Db molecule, but non-cross-reactive with H-2Ld, which is also expressed on P815 and shares 94% identity with H-2Db. The primers amplify a 558-bp fragment encompassing the region where the H-2IAd sequence is flanked by the H-2Db sequence. The products of this PCR amplification (Fig. 1 B) were verified by sequencing.
Despite expression of mutant H-2Db molecules at the messenger RNA level, immunofluorescence staining for H-2Db resulted in no detectable surface expression as compared with the wildtype control (Fig. 1 C). To test for potentially low levels of surface expression, transfectants were used as targets in a cytotoxicity assay that is generally more sensitive than FACS® analysis. The CD8 coreceptor-independent CTL line PR8.2, which is specific for the H-2Db- restricted influenza NP 366-374 peptide was used in a 51Cr-release assay where the level of killing of mutant transfectant targets pulsed with peptide was compared with that of P815-wtDb controls. Neither mutant molecule could sensitize P815 cells for lysis in the CTL assay (Fig. 1 D), demonstrating that the steady-state levels of mutant heavy chains available for peptide binding were below the detectable threshold for a CTL assay.
Mutant H-2Db Molecules Can Be Stabilized at the Cell Surface.To test whether mutant heavy chains that may be
reaching the cell surface in very limited quantities could be
captured and stabilized at the cell surface, transfectants were
incubated overnight at 26°C in the presence of excess influenza NP 366-374 peptide and
2m. Transfectants were
then labeled with 51Cr and used in the influenza peptide-
specific cytotoxicity assay. The results show that P815-Db219-233 was lysed comparably to P815-wtDb, but that
P815-Db196-257 was not specifically lysed (Fig. 2 A). We
conclude that the 15-amino acid mutant H-2Db molecules
can be stabilized at the cell surface by addition of exogenous peptide and
2m and that the stabilized molecule can present antigenic peptide to CTLs, suggesting that it is not
grossly misfolded. The phenotype of the Db196-257 is
much more severe, however, perhaps due to misfolding of
the molecule. Subsequent studies were carried out using
only the P815-Db219-233 transfectant.
|
To determine whether incubation at 26°C and addition
of exogenous peptide and
2m can upregulate surface expression enough to be detected by FACS® analysis, transfectants treated in this manner were stained with an antibody against the H-2Db molecule. The FACS® results
indicate that surface expression of the 15-amino acid mutant molecule can be detected at a level comparable to that of P815-wtDb maintained at 37°C (Fig. 2 B). In fact, mere
incubation at 26°C in the absence of peptide (but presence
of
2m) results in significant upregulation of Db219-233
cell surface expression.
To exclude the possibility of a randomly linked mutation related to general antigen processing and/or class I assembly, we examined the surface expression of H-2Kd in P815, P815-wtDb, and P815-Db219-233. Comparable levels of H-2Kd were seen in these cells (data not shown) suggesting that the defect in proper class I assembly is restricted to the mutant heavy chain.
Upregulation of Surface Expression of Mutant H-2Db Molecules Requires
2m.
The 15-amino acid mutant contains
substitutions within the class I
3 domain that could possibly affect the ability of
2m to bind to the heavy chain.
Substituted amino acid positions 231 and 233 are thought
to be 2 of the 13 contact sites between the
3 domain and
2m (40). However, the
1 and
2 domains contain 11 and 13 potential
2m interaction sites, respectively, so it seems unlikely that a change in only two
2m contact sites
would abrogate its interaction with the heavy chain. Still, it
is conceivable that substitutions made at these positions
could negatively affect the overall interaction between the
heavy chain and
2m to a degree such that proper class I
assembly in the ER does not occur, resulting in intracellular retention of the molecule. However, the fact that mutant H-2Db molecules are stabilized by addition of peptide
and
2m suggests that these molecules are capable of association with
2m. In fact, an appreciable upregulation of
surface expression is seen only in the presence of exogenous
2m and cannot be seen by the addition of peptide
alone (data not shown). Lack of upregulation of surface expression by peptide alone is also evident when cells treated in this manner are used as targets in a CTL assay (Fig. 3).
These results suggest that the mutant H-2Db heavy chain is
able to associate with
2m.
|
The phenotype of the mutant H-2Db
transfectants is reminiscent of that of the cell line RMA-S
as well as other TAP-deficient cell lines or cells lacking
2m (27). The low level of surface expression of class I
on RMA-S is due to deficient peptide loading via the TAP
complex. To determine whether a similar deficiency may
be occurring in P815-Db219-233, these cells were infected
with recombinant vaccinia virus containing a minigene
construct for the H-2Db-restricted influenza epitope (NP
366-374), which was either linked COOH terminally to
an ER insertion sequence (VV ES-NP) or not (VV NP).
The linking of an ER insertion sequence to the peptide allows for TAP-independent peptide translocation to the ER
(41, 42). If the inability of the mutant H-2Db molecule to
be loaded with peptide is due to a disruption in its association with TAP, infection with the vaccinia construct containing the ER insertion signal linked to the influenza peptide minigene should bypass TAP-dependent peptide loading
of the molecule. The use of these vaccinia-infected cells as
targets in the flu-specific CTL assay shows that P815-Db219-233 targets infected with the VV ES-NP were specifically killed, but those infected with the VV NP were
not (Fig. 4). Infection with either VV ES-NP or VV NP
rendered P815-wtDb targets equally susceptible to lysis,
whereas parental P815 were not lysed after infection with
either of the vaccinia constructs (Fig. 4). These results
demonstrate that TAP-dependent peptide transport to the
mutant H-2Db molecule is specifically impaired. In addition, these results reconfirm the fact that the mutant heavy
chain is capable of association with
2m. Thus, the
3 domain of class I must contain important sites of interaction
either directly or indirectly with TAP that are critical for
proper peptide loading and subsequent surface expression
of class I molecules.
|
The above results, showing a functional
defect in TAP-dependent peptide loading of the Db219-
233 molecule, suggest that the mutant heavy chain may be incapable of physical association with the TAP complex.
To test this, immunoprecipitation of [35S]methionine-labeled P815, P815-wtDb, or P815-Db219-233 was carried
out using antibodies specific for MHC class I heavy chain,
calnexin, TAP1, or TAP2. Immunoprecipitates were resolved using 2D NEPHGE-PAGE. Immunoprecipitation
of parental P815 cell lysate using heavy chain- and calnexin-specific antibodies revealed distinct spots that were
identified based on their predicted mobility to correspond
to the H-2Kd (mol wt = 39,368 daltons; pI = 6.43), H-2Dd
(mol wt = 37,278 daltons; pI = 5.13), and H-2Ld (mol wt
= 38,400 daltons; pI = 6.20) heavy chains (Fig. 5 A). The
same heavy chain pattern was observed when TAP-1- or
TAP-2-specific antibodies were used for immunoprecipitation (Fig. 5 B). In addition,
2m can be identified in all
precipitates, as well as several spots that, based on their molecular weight, could correspond to tapasin. However, since
the sequence of mouse tapasin is not yet published, we do
not know which of these, if any, represent tapasin. Precipitation of P815-wtDb lysate with anti-heavy chain or anticalnexin antibodies did not reveal an additional distinct
class I heavy chain, but resembled the pattern seen with
P815 (data not shown). This is most likely due to the indistinguishable migration patterns of H-2Db and H-2Ld because of their extensive sequence homology. However,
Db219-233 is predicted to migrate significantly differently
(mol wt = 38,295 daltons; pI = 7.19), and should be observed as a distinct spot. Indeed, precipitation of P815-Db219-233 lysate using anti-heavy chain antibodies revealed a new spot with a migration pattern expected for the
mutant H-2Db molecule (Fig. 5 A). Based on the intensity
of this spot, we conclude that Db219-233 is synthesized at a
level comparable to the three endogenous heavy chains (H-2Kd, H-2Ld, and H-2Dd). However, anti-TAP antibodies
precipitated significantly lower amounts (if any) of Db219-
233 compared with the endogenous heavy chains (Fig. 5
B). In contrast to what is seen in the TAP immunoprecipitates, more Db219-233 relative to the endogenous heavy
chains appears associated with calnexin (Fig. 5 A), consistent with the data in the previous figures indicating that this
molecule fails to traffic efficiently to the cell surface and,
hence, accumulates in the ER.
|
| |
Discussion |
|---|
|
|
|---|
We have shown that substitution of amino acids 219-
233 within the
3 domain of H-2Db results in the loss of its
expression at the cell surface. Cell surface expression of
Db219-233 can be rescued by incubation at 26°C with addition of excess peptide and
2m. The rescued molecule is
functional in its ability to present exogenous peptide for recognition by CD8+ T cells, suggesting that substitutions
introduced into the
3 domain do not grossly affect the
conformation of the molecule. P815-Db219-233 exhibits a
phenotype very similar to that of RMA-S cells, which led
us to believe that the defect of Db219-233 expression is
due to a lack of TAP-dependent peptide loading. This was
demonstrated by the ability of Db219-233 to present endogenous influenza NP 366-374 peptide only when it is
linked COOH terminally to an ER insertion sequence, thus allowing it to bypass the requirement for TAP-dependent peptide loading. Finally, the functional defect in TAP-mediated peptide translocation to Db219-233 correlates
with the finding that physical association of Db219-233
with the TAP complex is drastically reduced. Together, these results argue that amino acids 219-233 of the
3 domain serve as an important docking site for the TAP complex during the assembly of MHC class I molecules.
Although human
2m is clearly binding to Db219-233,
as evidenced by the requirement for human
2m to stabilize the Db219-233 at the cell surface (Fig. 3), this does not
necessarily reflect the ability of mouse
2m to bind Db219-
233. Still, the fact that antigen presentation by Db219-233
occurs when peptides are targeted to the ER in a TAP-independent manner (Fig. 4) provides evidence that mouse
2m too is binding to the mutant heavy chain. If the lack
of Db219-233 surface expression and antigen presentation
were due to impaired
2m binding, the phenotype would
remain consistent, even when peptides are targeted to the
ER by linkage to an ER insertion sequence.
It has been previously suggested that TAP may associate
with the
3 domain of the class I heavy chain. This was
based on findings that substitution of a single amino acid
within the
3 domain (H-2Ld227 or H-2Dd222) can result
in the loss of class I association with TAP, as determined in
coprecipitation studies (11, 22). However, these molecules
are still present at the cell surface at levels detectable by
FACS® analysis (24) and are able to present endogenous
peptides (26), suggesting that a true loss of TAP-dependent
peptide loading has not occurred. Still, the loss of class I-TAP
association as detected in immunoprecipitations using H-2Ld
227 and H-2Dd 222 hints to the
3 domain as an important
site of interaction with the TAP complex. It is known that
the association between TAP and class I is very labile in
most detergents other than digitonin (10). Perhaps the
change of even one critical residue involved in TAP association renders this interaction even more labile, even in
mild detergents. This change, however, must not abrogate the in vivo function of TAP in loading peptide onto class I. This could explain why H-2Ld227 and H-2Dd222 are still
expressed and function normally at the cell surface, yet are
shown by immunoprecipitation not to associate with TAP. Perhaps caution must be taken when interpreting the results of immunoprecipitations that indicate a lack of TAP
association with class I molecules. This is further supported
by the findings of allelic variations in the ability of human
class I heavy chains to associate with TAP, as HLA-B35 alleles do not coprecipitate with TAP (43) and yet are expressed at the cell surface and present antigenic peptides efficiently (44, 45).
Point mutations of the
2 domain of the human class I
molecule HLA-A0201 (position 134) results in ~80% reduced surface expression and diminished ability to present
endogenous antigens (46, 47), implicating the
2 domain
of the heavy chain in binding to TAP. However, the same
mutant molecule is rapidly transported to the cell surface
without bound peptides. Apparently, this molecule escapes
degradation that normally happens to the majority of partially assembled class I molecules (21). It has therefore been
suggested that mutation at position 134 disrupts interaction
with an accessory molecule (such as calreticulin) responsible for sorting the peptide-free class I molecules to the degradative pathway and/or ER retention of unloaded molecules (48). Our results do not exclude the role of the
2
domain in contributing to class I association with TAP. In
fact, an
2 domain contact with the TAP complex could
enhance the association necessary for peptide transfer onto
the class I molecule. We do show, however, that a net
change of 11 amino acids within the
3 domain is sufficient to dissociate class I from TAP function.
| |
Footnotes |
|---|
Address correspondence to Stanislav Vukmanovic, Division of Immunology, Department of Pathology, NYU Medical Center, 550 First Ave., New York 10016. Phone: 212-263-6040; Fax: 212-263-8179; E-mail: vukmas01{at}mcrcr6.med.nyu.edu
Received for publication 5 November 1997 and in revised form 6 January 1998.
1Abbreviations used in this paper:
2m,
2-microglobulin; ER, endoplasmic
reticulum; ES, E3/19K leader/signal sequence; NEPHGE, nonequilibrium pH-gradient gel electrophoresis; NP, nucleoprotein; RP10, RPMI
1640/10% FCS; TAP, transporter associated with antigen processing; VV,
vaccinia virus; wt, wild type.
The authors thank Sean Uiterwyk (New York University Medical School, New York) for assistance in generating mutant fragments, Adolfo Garcia-Sastre (Mount Sinai Medical School, New York) for the influenza A/PR8/34 virus, John Hirst (New York University Medical School, New York) for the FACS® analysis, Moriya Tsuji (New York University Medical School, New York) for help with the vaccinia experiments, and David Ginsburg (University of Cincinnati, OH) for the technical assistance with 2D NEPHGE-PAGE.
This work was supported by the Markey Charitable Trust Junior Investigator Award, National Cancer Institute core support grant 5P30 CA-16087, and National Institutes of Health grant AI-33605.
| |
References |
|---|
|
|
|---|
| 1. | Schumacher, T.N.M., M.-T. Heemels, J.J. Neefjes, W.M. Kast, C.J.M. Melief, and H.L. Ploegh. 1990. Direct binding of peptide to empty MHC class I molecules on intact cells and in vitro. Cell. 62: 563-567 [Medline]. |
| 2. | Townsend, A., C. Ohlen, J. Bastin, H.-G. Ljungren, L. Foster, and K. Karre. 1989. Association of class I major histocompatibility heavy and light chains induced by viral peptides. Nature. 340: 443-448 [Medline]. |
| 3. | Van Bleek, G.M., and S.G. Nathenson. 1990. Isolation of an endogenously processed immunodominant viral peptide from the class I H-2Kb molecule. Nature. 348: 213-216 [Medline]. |
| 4. | Falk, K., O. Rotzschke, S. Stevanovic, G. Jung, and H.-G. Rammensee. 1991. Allele-specific motifs revealed by sequencing of self-peptides eluted from MHC molecules. Nature. 351: 290-296 [Medline]. |
| 5. |
Tector, M., and
R.D. Salter.
1995.
Calnexin influences folding of human class I histocompatibility proteins but not their
assembly with beta 2-microglobulin.
J. Biol. Chem.
270:
19638-19642
|
| 6. | Vasillakos, A., M. Cohen-Doyle, P.A. Peterson, M.R. Jackson, and D.B. Williams. 1996. The molecular chaperone calnexin facilitates folding and assembly of class I histocompatibility molecules. EMBO (Eur. Mol. Biol. Organ.) J. 15: 1495-1506 [Medline]. |
| 7. | Shepherd, J.C., T.N.M. Schumacher, P.G. Ashton-Rickardt, S. Imaeda, H.L. Ploegh, C.A. Janeway, and S. Tonegawa. 1993. TAP1-dependent peptide translocation in vitro is ATP-dependent and peptide selective. Cell. 74: 577-584 [Medline]. |
| 8. |
Neefjes, J.J.,
F. Momburg, and
G.J. Hammerling.
1993.
Selective and ATP-dependent translocation of peptides by the MHC-encoded transporter.
Science.
261:
769-771
|
| 9. |
Suh, W.-K.,
M.F. Cohen-Doyle,
K. Fruh,
K. Wang,
P.A. Peterson, and
D.B. Williams.
1994.
Interaction of MHC class
I molecules with the transporter associated with antigen processing.
Science.
264:
1322-1326
|
| 10. |
Ortmann, B.,
M. Androlewicz, and
P. Cresswell.
1994.
MHC class I/ 2-microglobulin complexes associate with
TAP transporters before peptide binding.
Nature.
368:
864-867
[Medline].
|
| 11. | Carreno, B.M., J.C. Solheim, M. Harris, I. Stroynowski, J.M. Connolly, and T.H. Hansen. 1995. TAP associates with a unique class I conformation, whereas calnexin associates with multiple class I forms in mouse and man. J. Immunol. 155: 4726-4733 [Abstract]. |
| 12. |
Androlewicz, M.J.,
B. Ortmann,
P.M. van Endert,
T. Spies, and
P. Cresswell.
1994.
Characteristics of peptide and major
histocompatibility complex class I/ 2-microglobulin binding
to the transporters associated with antigen processing (TAP1
and TAP2).
Proc. Natl. Acad. Sci. USA.
91:
12716-12720
|
| 13. | Shimizu, Y., and R. Demars. 1989. Production of human cells expressing individual transferred HLA-A, -B, -C genes using and HLA-A, -B, -C null human cell line. J. Immunol. 142: 3320-3328 [Abstract]. |
| 14. |
Grandea, A.G.I.,
M.J. Androlewic,
R.S. Athwal,
D.E. Geraghty, and
T. Spies.
1995.
Dependence of peptide binding
by MHC class I molecules on their interaction with TAP.
Science.
270:
105-108
|
| 15. | Sadasivan, B., P.J. Lehner, B. Ortmann, T. Spies, and P. Cresswell. 1996. Roles of calreticulin and a novel glycoprotein, tapasin, in the interaction of MHC class I molecules with TAP. Immunity. 5: 103-114 [Medline]. |
| 16. |
Li, S.,
H.-O. Sjogren,
U. Hellman,
R.F. Pettersson, and
P. Wang.
1997.
Cloning and functional characterization of a
subunit of the transporter associated with antigen processing.
Proc. Natl. Acad. Sci. USA.
94:
8708-8713
|
| 17. |
Ortmann, B.,
J. Copeman,
P.J. Lehner,
B. Sadasivan,
J.A. Herberg,
A.G.I. Grandea,
S.R. Riddell,
R. Tampe,
T. Spies,
J. Trowsdale, and
P. Cresswell.
1997.
A critical role for tapasin in
the assembly and function of multimeric MHC class I-TAP
complexes.
Science.
277:
1306-1309
|
| 18. |
Solheim, J.C.,
M.R. Harris,
C.S. Kindle, and
T.H. Hansen.
1997.
Prominence of 2-microglobulin, class I heavy chain
conformation, and tapasin in the interactions of class I heavy
chain with calreticulin and the transporter associated with antigen processing.
J. Immunol.
158:
2236-2241
[Abstract].
|
| 19. | Wei, M., and P. Cresswell. 1992. HLA-A2 molecules in an antigen-processing mutant cell contain signal sequence-derived peptides. Nature. 356: 443-446 [Medline]. |
| 20. |
Henderson, R.A.,
H. Michel,
K. Sakaguchi,
J. Shabanowitz,
E. Appella,
D.F. Hunt, and
V.H. Engelhard.
1992.
HLA-A2.1- associated peptides from a mutant cell line: a second pathway of antigen presentation.
Science.
255:
1264-1266
|
| 21. |
Hughes, E.,
C. Hammond, and
P. Cresswell.
1997.
Misfolded major histocompatibility complex class I heavy chains
are translocated into the cytoplasm and degraded by the proteasome.
Proc. Natl. Acad. Sci. USA.
94:
1896-1901
|
| 22. |
Suh, W.-K.,
E.K. Mitchell,
Y. Yang,
P.A. Peterson,
G.L. Waneck, and
D.B. Williams.
1996.
MHC class I molecules
form ternary complexes with calnexin and TAP and undergo
peptide-regulated interaction with TAP via their extracellular domains.
J. Exp. Med.
184:
337-348
|
| 23. | Lee, N., A.R. Malacko, A. Ishitani, M.-C. Chen, J. Bajorath, H. Marquardt, and D.E. Geraghty. 1995. The membrane-bound and soluble forms of HLA-G bind identical sets of endogenous peptides but differ with respect to TAP association. Immunity. 3: 591-600 [Medline]. |
| 24. | Potter, T.A., T.V. Rajan, R.F. Dick II, and J.A. Bluestone. 1989. Substitution at residue 227 of H-2 class I molecules abrogates recognition by CD8-dependent, but not CD8-independent, cytotoxic T lymphocytes. Nature. 337: 73-75 [Medline]. |
| 25. |
Connoly, J.,
T.H. Hansen,
A.L. Ingold, and
T.A. Potter.
1990.
Recognition by CD8 on cytotoxic T lymphocytes is
ablated by several substitutions in the class I 3 domain: CD8
and the T-cell receptor recognize the same class I molecule.
Proc. Natl. Acad. Sci. USA.
87:
2137-2141
|
| 26. |
Killeen, N.,
A. Moriarty,
H.-S. Teh, and
D.R. Littman.
1992.
Requirement for CD8-major histocompatibility complex class I interaction in positive and negative selection of
developing T cells.
J. Exp. Med.
176:
89-97
|
| 27. |
Williams, D.B.,
B.H. Barber,
R.A. Flavell, and
H. Allen.
1989.
Role of 2-microglobulin in the intracellular transport
and surface expression of murine class I histocompatibility
molecules.
J. Immunol.
142:
2796-2806
[Abstract].
|
| 28. |
Vitiello, A.,
T.A. Potter, and
L.A. Sherman.
1990.
The role
of 2-microglobulin in peptide binding by class I molecules.
Science.
250:
1423-1426
|
| 29. | Attaya, M., S. Jameson, C.K. Martinez, E. Hermel, C. Aldrich, J. Forman, K. Fischer-Lindahl, M.J. Bevan, and J.J. Monaco. 1992. Ham-2 corrects the class I antigen processing- defect in RMA-S cells. Nature. 355: 647-649 [Medline]. |
| 30. | Spies, T., V. Cerundolo, M. Collona, P. Cresswell, A. Townsend, and R. DeMars. 1992. Presentation of viral antigen by MHC class I molecules is dependent on a putative peptide transporter heterodimer. Nature. 355: 644-646 [Medline]. |
| 31. | Joly, E., and M.B.A. Oldstone. 1991. Manufacture of a functional cDNA for the H-2Db molecule using a retroviral shuttle vector. Immunogenetics. 34: 62-65 [Medline]. |
| 32. |
Jhaver, K.G.,
T.D. Rao,
A.B. Frey, and
S. Vukmanovi .
1995.
Apparent split tolerance of CD8+ T cells from 2-microglobulin-deficient ( 2m / ) mice to syngeneic 2m+/+
cells.
J. Immunol.
154:
6252-6261
[Abstract].
|
| 33. |
Eisenlohr, L.C.,
I. Ba ík,
J.P. Bennink,
K. Bernstein, and
J.W. Yewdell.
1992.
Expression of a membrane protease enhances presentation of endogenous antigens to MHC class I-
restricted T lymphocytes.
Cell.
71:
963-972
[Medline].
|
| 34. |
Ba ík, I.,
J.H. Cox,
R. Anderson,
J.W. Yewdell, and
J.R. Bennink.
1994.
TAP-independent presentation of endogenously
synthesized peptides is enhanced by endoplasmic reticulum
insertion sequences when located at the amino but not carboxy terminus of the peptide.
J. Immunol.
152:
381-387
[Abstract].
|
| 35. |
Chakrabarti, S.,
K. Brechling, and
B. Moss.
1985.
Vaccinia virus
expression vector: coexpression of beta-galactosidase provides visual screening of recombinant virus plaques.
Mol. Cell. Biol.
5:
3403-3409
|
| 36. | Brown, M.G., J. Driscoll, and J.J. Monaco. 1991. Structural and serological similarity of MHC-linked LMP and proteasome (multicatalytic proteinase) complexes. Nature. 353: 355-357 [Medline]. |
| 37. |
Nandi, D.,
E. Woodward,
D.B. Ginsburg, and
J.J. Monaco.
1997.
Intermediates in the formation of mouse 20S proteasomes: implications for the assembly of precursor subunits.
EMBO (Eur. Mol. Biol. Organ.) J.
16:
5363-5375
[Medline].
|
| 38. |
Machold, R.P.,
S. Andree,
L. Van Kaer,
H.-G. Ljunggren, and
H.L. Ploegh.
1995.
Peptide influences the folding and
intracellular transport of free major histocompatibility complex class I heavy chains.
J. Exp. Med.
181:
1111-1122
|
| 39. | Brown, J.H., T.S. Jardetzky, J.C. Gorga, J.C. Stern, R.G. Urban, J.L. Strominger, and D.C. Wiley. 1993. Three-dimensional structure of the human class II histocompatibility antigen HLA-DR1. Nature. 364: 33-39 [Medline]. |
| 40. | Bjorkman, P.J., M.A. Saper, B. Samraoui, W.S. Bennett, J.L. Strominger, and D.C. Wiley. 1987. Structure of the human class I histocompatibility antigen, HLA-A2. Nature. 329: 506-512 [Medline]. |
| 41. |
Anderson, K.,
P. Cresswell,
M. Gammon,
J. Hermes,
A. Williamson, and
H. Zweerink.
1991.
Endogenously synthesized
peptide with an endoplasmic reticulum signal sequence sensitizes antigen processing mutant cells to class I-restricted cell-mediated lysis.
J. Exp. Med.
174:
489-492
|
| 42. |
Eisenlohr, L.C.,
J.W. Yewdell, and
J.R. Bennink.
1992.
Flanking sequences influence the presentation of an endogenously synthesized peptide to cytotoxic T lymphocytes.
J. Exp. Med.
175:
481-487
|
| 43. | Neisig, A., R. Wubbolts, X. Zang, C. Melief, and J. Neefjes. 1996. Allele-specific differences in the interaction of MHC class I molecules with transporters associated with antigen processing. J. Immunol. 156: 3196-3206 [Abstract]. |
| 44. | Ooba, T., H. Hayashi, S. Karaki, M. Tanabe, K. Kano, and M. Takiguchi. 1989. The structure of HLA-B35 suggests that it is derived from HLA-Bw58 by two genetic mechanisms. Immunogenetics. 30: 76-80 [Medline]. |
| 45. | Koziel, M.J., D. Dudley, J.T. Wong, J. Dienstag, M. Houghton, R. Ralston, and B.D. Walker. 1992. Intrahepatic cytotoxic T lymphocytes specific for hepatitis C virus in persons with chronic hepatitis. J. Immunol. 149: 3339-3344 [Abstract]. |
| 46. | Lewis, J.W., A. Neisig, J. Neefjes, and T. Elliott. 1996. Point mutations in the a2 domain of HLA-A2.1 define a functionally relevant interaction with TAP. Curr. Biol. 6: 873-883 [Medline]. |
| 47. | Peace-Brewer, A.L., L.G. Tussey, M. Matsui, G. Li, D.G. Quinn, and J.A. Frelinger. 1996. A point mutation in HLA-A*0201 results in failure to bind the TAP complex and to present virus-derived peptides to CTL. Immunity. 4: 505-514 [Medline]. |
| 48. | Elliott, T.. 1997. How does TAP associate with MHC class I molecules. Immunol. Today. 18: 375-379 [Medline]. |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||