From the Institute of Experimental Immunology, CH-8091 Zürich, Switzerland
We studied the impact of various infectious and proinflammatory agents on the induction of
peripheral T cell tolerance. Adoptive transfer of CD8+ T cells from lymphocytic choriomeningitis virus (LCMV) T cell receptor transgenic mice into LCMV antigen transgenic mice expressing the LCMV glycoprotein epitope (gp) 33-41 under control of a major histocompatibility complex class I promoter led to efficient induction of peripheral tolerance after a period of
transient activation. If, however, the recipient mice were challenged with viral or bacterial infections or proinflammatory agents (lipopolysaccharide or Poly:IC) early after cell transfer, tolerance induction was prevented and instead, CD8+ T cell activation leading to vigorous expansion and generation of cytolytic activity ensued. This became manifest in significant immunopathology mainly involving destruction of the splenic architecture and lysis of antigen-expressing lymphocyte and macrophage populations. Important parameters involved in the activation of host-reactive T cells by nonspecific infectious agents included the presence, localization, and quantity of the specific transgene-encoded self-antigen; in contrast, CD4+ T cells
were not required. In mice surviving the acute phase, the transferred CD8+ T cells persisted at
high levels in an anergic state; they were unable to generate cytolytic activity in vitro or to
control LCMV infection in vivo. These results impinge on our understanding of the role of infectious agents in graft verus host reactions towards minor histocompatibility antigens.
 |
Introduction |
Tcell tolerance to self-antigens expressed in the thymus
primarily occurs via clonal deletion of immature thymocytes. In addition, various mechanisms of peripheral T
cell tolerance have been described, which maintain unresponsiveness of clones that are potentially reactive to peripheral self-antigens, which may be underrepresented in
the thymus. (a) One mechanism, ignorance, is where the
antigen is not encountered by the T cell during its normal
recirculation pathway in sufficient quantity to cause immune reactivity (1, 2). This state of tolerance can be broken if antigen is introduced into lymphoid tissue, i.e., into
a location where T cells find appropriate qualitative and
quantitative conditions to be activated (3). (b) Another is
anergy, where contact with antigen induces functional unresponsiveness (4, 5). T cell anergy can be reversed if continuous contact with the tolerogen is lacking (6), and partial reversion of anergy may also be induced by infectious agents (7). (c) There is also peripheral clonal deletion where contact with antigen induces cell death (8). This may
be the consequence of a powerful, exhaustive immune response (8, 10), but may also only be preceded by a brief period of activation, which is of limited functional relevance
(11). Obviously, this form of tolerance is irreversible; it has
been described, however, that proinflammatory agents such
as LPS may interfere with the induction of tolerance and
instead lead to T cell activation under certain conditions
(12).
Peripheral deletion of T cells induced by MHC-presented peptide antigens has been widely studied using T
cells from TCR transgenic mice adoptively transferred into
mice expressing their nominal antigen. Thus, it was shown
that naive H-Y-specific T cells transfused into nude male
hosts largely disappeared after a period of extensive proliferation, leaving behind a small proportion of anergic cells (9). Similar observations have been made using mice expressing a transgenic TCR specific for Kb (16) or Ld (17).
Evidence has also been presented that more restricted tissue-specific antigen expression may be sufficient to cause peripheral T cell deletion (18).
Surprisingly, even though large numbers of antigen-specific cytotoxic T cells were transferred and activated in the
experimental systems described above, peripheral deletion
usually occurred without immunopathological consequences.
This is in contrast to the situation encountered during bone
marrow transplantation, when transfusion of large numbers
of lymphocytes into hosts ubiquitously expressing major or
minor histocompatibility antigens that may be recognized
by donor cells frequently leads to activation and severe immunopathology resulting in the clinical picture of graft versus host (GVH)1 disease (19). The factors important for activation versus tolerance of host-specific T cells after bone
marrow transplantation have not been characterized in detail. An interesting clinical and experimental observation is,
however, that infections may exacerbate and aggravate
GVH disease (20).
In this study we describe a model system where naive
CD8+ T cells specific for a lymphocytic choriomeningitis
virus (LCMV) peptide were transferred into mice expressing this nominal LCMV epitope as a transgene under control of an ubiquitous promoter; this situation is comparable
to a defined minor histocompatibility antigen difference.
Similar to previous studies, we found that the specific T
cells were deleted after a period of transient activation. If,
however, an inflammatory process was created by viral or
bacterial infections or by the injection of LPS or Poly:IC, the CD8+ T cells were activated by the transgene-encoded
self-antigen, vigorously expanded, and caused significant
immunopathology similar to a GVH reaction.
 |
Materials and Methods |
Gene Constructions and Transgenic Mice.
To generate mice with
ubiquitous expression of an LCMV-derived CTL epitope, we
constructed a hybrid LCMV/H-2Kb transgene. In this construct,
the 5
part of exon 1 of the genomic Kb gene encoding amino acids (aa) 1-12 was replaced by a cDNA fragment encoding aa 1-60
of the LCMV glycoprotein (Fig. 1 a). For this, the EcoRI fragment of the genomic Kb gene (provided by Dr. B. Arnold,
Deutsches Krebsforschungszentrum, Heidelberg, Germany) was
cloned into the EcoRI site of pUC 19 (pRIKb10). In this plasmid,
the NruI/XmaIII fragment (encoding aa 1-12 of exon 1 of the
Kb molecule) was replaced by a PCR product encoding aa 1-60 of
the LCMV glycoprotein gene. The PCR product was generated
from the pKOOL plasmid (1) encoding the BamHI fragment of
the LCMV glycoprotein (GP) cDNA. For the PCR reaction 5
(TCGCGAGGATTCTATCCAGTAAAAGGATGG) and 3
(CTGTGGCATGTACGGCCGTAATG) primers were used
which contained Nru1 and XmaIII restriction sites at their 5
and
3
ends, respectively. The LCMV GP fragment was inserted such
that the following Kb aa sequence was put out of frame leading to
a premature stop in exon 2 of the Kb gene. The final transgenic
construct was controlled by nucleotide sequencing of the replaced region. The transgene was microinjected into fertilized
C57BL/6 oocytes and founder number 8 (official nomenclature:
TgN (LCMVGP33) 224 Zbz; designated H8 in this manuscript) was used in this study.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 1.
Functional presentation of gp 33-41 in H8 mice. (a) The
transgene construct: a fragment of the LCMV glycoprotein sequence including the gp 33-41 CTL epitope was cloned into the genomic sequence of H-2Kb. (b and c) Functional expression of gp 33-41 in peripheral lymphoid tissue. (b) Spleen cells from day 8 immune C57BL/6 mice
were used as effector cells against Con A blast target cells obtained from H8 or C57BL/6 mice; as a control, C57BL/6 Con A blast target cells pulsed with gp 33-41 were used. Spontaneous release was <28%. (c) H8-,
C57BL/6-, and gp 33-41-pulsed C57BL/6 spleen cells were used as stimulators for TCR318 responder spleen cells in a [3H]thymidin incorporation assay. (d) Functional gp 33 expression on fibroblasts. Embryonal fibroblasts from H8 and C57BL/6 mice were left unmanipulated or were
pulsed with gp 33-41 and used as targets for effector cells obtained from
LCMV-WE-infected C57BL/6 mice in a 5-h 51Cr-release assay; spontaneous release was <30%.
|
|
C57BL/6 mice were obtained from the Institut für Labortierkunde (University of Zürich, Zürich, Switzerland). The transgenic mice expressing a V
2/V
8.2 T cell receptor specific for aa
33-41 of the LCMV glycoprotein 1 in association with H-2 Db
(TCR327 mice) on 50% of all CD8+ T cells have been described
previously (21). Perforin-deficient and recombination activating
gene (RAG)1-deficient TCR318 mice (TCR318-Pfptm and
TCR318-RAG1tm mice, respectively) were bred by crossing
mice of line 318 to perforin-deficient (22) or RAG-1-deficient
(23) animals. For preparation of bone marrow chimeras, recipient
mice were exposed to 1,000 centiGrey (cGy) and 24 h later injected intravenously with 107 untreated bone marrow cells. Mice
were depleted of CD4+ T cells as described (24). All mice were
kept under specific pathogen-free conditions.
Infectious and Proinflammatory Agents.
LCMV strain WE (LCMV-WE) was originally obtained from F. Lehmann-Grube (Heinrich-Pette-Institut fuer Experimentelle Virologie, University of Hamburg, Hamburg, Germany) and was propagated on L 929 fibroblast
cells. The LCMV-WE CTL escape variant 8.7 was generated by
injection of TCR318 mice with the parental WE strain (25). Virus titers in infected organs were determined using a virus plaque
assay on MC57G cells as described previously (26). Vaccinia virus
WR and the recombinant vaccinia viruses expressing the LCMV
nucleoprotein (NP) (obtained from Dr. H.L. Bishop, Institute of
Virology, Oxford University, Oxford, UK) and aa 1-57 of the LCMV GP (obtained from Dr. Linsey Whitton, Scripps Research
Institute, La Jolla, CA) were grown on BSC 40 cells and plaqued
on the same cells. Listeria monocytogenes (originally obtained from
R.V. Blanden, Australian National University, Canberra, Australia) was kept and prepared as described previously (27). All pathogens as well as Poly:IC (Fluka, Chemie Ab, Buchs, Switzerland)
and LPS Escherichia coli 026:B6 (Chemie Brunschwig AG, Basel,
Switzerland) were injected intravenously.
FACS® Analysis.
For detection of TCR318 T cells in recipient mice, spleen cells or PBLs were incubated with FITC-labeled
anti-CD8, PE-labeled anti-V
2, and biotinylated anti-TCR V
8
(all from PharMingen, San Diego, CA) mAb followed by Tricolor-streptavidin (CALTAG Labs., South San Francisco, CA;
reference 28). For the detection of activation markers, biotinylated anti-CD62 ligand (L), CD44, and CD49d (all from PharMingen) mAb were used instead of anti-TCR V
8. To analyze
the splenic lymphocyte subsets, spleen cells were stained with
FITC anti-B220, PE anti-CD4 and biotinylated anti-CD8 (all
from PharMingen), followed by Tricolor-streptavidin. Cells were
analyzed on a FACScan® flow cytometer (Becton Dickinson,
Mountain View, CA).
Functional CTL Assays.
For determination of ex vivo cytolytic activity, effector spleen cell suspensions were prepared.
EL-4 target cells were coated with the LCMV peptides glycoprotein epitope (gp) 33-41, np 396-404 (10
6 molar for 2 h), or left
untreated. 51Cr-release assays were performed according to standard protocols (29) at the indicated effector/target ratios using
5- or 15-h incubation periods. For some experiments, effector cells
were restimulated for 5 d with thioglycolate-induced LCMV-WE-infected macrophages before the 51Cr-release assay. Con A
blast target cells were obtained by incubating spleen cells of naive
mice at 2 × 106 cells/ml in IMDM 10% FCS containing 5 µg/ml
Con A. After 3 d of stimulation, the cells were harvested, purified
by a Ficoll gradient, and labeled with 51Cr. Embryonal fibroblast
target cells were obtained by culturing single-cell suspensions
from day 14-19 embryos, which were trypsinized after decapitation and removal of the liver. They were seeded into 96-well
plates at a concentration of 2 × 104 cells per well on the day before the assay. Then, 10 µl of 51Cr (10 µCi) were added for 3 h,
the cells were washed three times in the plates, and effector cells
were added at standard effector dilutions. For in vitro T cell proliferation assays, 5 × 105 responder spleen cells were restimulated
in vitro on 2 × 105 irradiated C57BL/6 spleen cells pulsed with
LCMV gp 33. Responder cell proliferation was assessed after 48 h
of proliferation of culture by addition of [3H]thymidine (25 µCi/
well) for the last 12 h of incubation. T cell proliferation in vivo
was assessed in the lymph nodes of recipient mice 40 h after transfer of TCR318 spleen cells labeled with the fluorescent dye 5,6 carboxyfluorescein diacetate succinimidyl ester (CFSE; Molecular
Probes, Eugene, OR). For fluorescence labeling, spleen cells
were incubated at a concentration of 5 × 106 cells/ml in buffered
saline solution containing 0.5 µmolar CFSE for 10 min at 37°C.
Histology and Immunohistology.
Histological procedures were
performed as described previously (30) using the following primary antibodies: anti-CD8 (YTS 169; reference 24), anti-CD4
(YTS 191; reference 24), anti-B220 (PharMingen), anti-marginal
metallophils (MMs; metallophilic macrophage 1; Biomedicals,
Augst, Switzerland), and anti-follicular dendritic cells (FDCs; 4C11;
reference 31). Primary rat mAb were revealed by a twofold sequential incubation with rabbit anti-rat Ig and rat alkaline phosphatase anti-alkaline phosphatase complex (DAKO, Glostrup, Denmark) followed by naphthol AS-B1 phosphate and New Fuchsin
as substrate for the color reaction. Peripheral blood and bone
marrow cytology were determined as described previously (32).
 |
Results |
Functional Expression of LCMV gp 33-41 in H8 Mice.
Functional expression of LCMV gp 33-41 in H8 mice was
verified in the following experiments. (a) Con A-stimulated T cell blasts from H8 mice were effectively lysed by
spleen cells from C57BL/6 mice that had been infected
with 200 pfu of LCMV-WE 8 d previously (Fig. 1 b). (b)
Spleen cells of H8 mice caused proliferation of LCMV-specific TCR transgenic responder cells to a similar extent as
spleen cells from C57BL/6 mice exogenously loaded with
the synthetic gp 33 peptide (Fig. 1 c). (c) Embryonal fibroblasts of H8 mice were specifically lysed by LCMV-specific
effector cells, albeit to a lesser extent than gp 33-labeled
fibroblasts obtained from C57BL/6 mice (Fig. 1 d). (d)
Analysis of H8 mice crossed to mice transgenic for a gp
33-specific TCR revealed extensive thymic deletion of gp
33-specific CD8+ T cells (data not shown), leading to complete and specific tolerance of gp 33-reactive CTLs. Collectively, these data suggest that the gp 33 epitope was functionally presented by both lymphoid and nonlymphoid cells
in H8 mice.
Peripheral Tolerance Induction After Transient Activation of
Transferred gp 33-specific CD8+ T Cells in H8 Mice.
To study
the fate of gp 33-reactive CD8+ T cells after exposure to
an environment, where their nominal antigen is widely expressed both on lymphoid and nonlymphoid cells, we
transfused nonirradiated H8 and littermate control mice
with 5 × 107 spleen cells from RAG1-deficient TCR
transgenic (TCR318-RAGtm) mice, which had been labeled with the fluorescent dye CFSE. 40 h later, CD8+ T
cells of lymph nodes of recipient mice were analyzed by
flow cytometry. Fig. 2 a shows that in lymph nodes of littermate control mice, one discrete peak of CFSEhi cells
could be identified. In contrast, analysis of lymph node cells
of H8 mice revealed several peaks of lower intensity (Fig. 2 b), suggesting that the antigen-specific donor T cells had
undergone several rounds of cell division. (Fig. 2 c). Downregulation of CD62L and elevated expression of CD44
(Fig. 2 d) on CD8+ T cells further supported the observation that the TCR318-RAGtm CFSElo population had
been activated after transfer into H8 mice.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 2.
Peripheral tolerance induction after transient activation of transferred gp 33-specific CD8+ T cells in H8 mice. (a-d) H8 and littermate contol mice were transfused with 5 × 107 CFSE-labeled spleen cells from RAG1-deficient mice transgenic for a gp 33-41-specific T cell receptor
(TCR×RAG). 40 h after transfer, mesenteric lymph node cells were analyzed by flow cytometry. CFSE staining of CD8+ cells from littermate (B6; a) or
H8 recipient mice (b) is shown. CFSE+ CD8+ lymph node cells from both recipients were compared for their expression of CD62L (c) and CD44 (d). (e)
Spleen cells of H8 mice transfused with 5 × 107 spleen cells from TCR318 mice were analyzed at the indicated times after transfer for gp 33-specific cytotoxicity on EL-4 target cells in a 15-h 51Cr-release assay. Spleen cells from C57BL/6 mice immunized with LCMV-WE 50 d earlier (B6 memo) were
used as control. Spontaneous release was <25%. ( f ) H8 mice and littermate control (B6) mice were transfused with the indicated number of spleen cells from TCR318 mice. The percentage of CD8+ PBLs expressing the transgenic V and V chains was monitored at the indicated time points before and
after challenge infection with 200 PFU LCMV.
|
|
Although these phenotypic markers provided evidence
for activation of transgenic CD8+ T cells, further analysis
revealed that this was not of major functional consequence.
Spleen cells of recipient mice did not show gp 33-specific
cytotoxicity in a sensitive 15-h 51Cr-release assay 1, 3, 6, or
8 d after transfer of 5 × 107 TCR318 spleen cells (Fig. 2 e).
Also, no signs of immunopathology could be demonstrated
by clinical observation, histology (not shown), or lysis of gp
33-expressing recipient lymphocytes (Table 1, experiment
A, see below). Finally, cell division appeared limited as
TCR318 CD8+ T cells remained undetectable in FACS®
analysis of recipient spleen cells using TCR V
2/V
8-specific antibodies (Fig. 2 f, days 1-12).
To evaluate the further fate of the transferred TCR318
CD8+ T cells, the recipient mice were infected with 200 PFU LCMV-WE 12 d after transfer. Fig. 2 f shows that infection of control mice transfused with as little as 106 spleen
cells (containing ~5 × 104 TCR318 CD8+ T cells) lead to
vigorous expansion of the transgenic T cells, whereas in H8
mice, even after transfer of 5 × 107 spleen cells, no
TCR318 T cells could be restimulated by the virus infection. Also, attempts to recover gp 33-reactive CD8+ T
cells in vitro by antigen-specific restimulation in the presence of Con A supernatant were unsuccessful (data not
shown). Thus, it appears likely that, as previously described
in similar experimental systems, transfer of TCR318 T cells
into mice widely expressing their nominal antigen leads to
clonal deletion and/or induction of anergy after a period of
transient activation. Experiments using bone marrow chimeras revealed that this peripheral tolerance induction was
equally efficient whether the peptide was expressed only on
bone marrow-derived cells or predominantly in nonlymphoid tissues (not shown).
Virus Infection Interferes with Tolerance Induction and Causes
CD8+ T Cell-mediated Immunopathology.
The experiments
described above confirmed the finding that high numbers
of potentially host-reactive cells can be efficiently rendered
tolerant in the periphery without causing damage to host tissue. To address the question of whether infectious agents
may influence this tolerization process, we infected H8 and
littermate control mice with 200 PFU LCMV-WE 1-3 d
after transfer of 106 TCR318 spleen cells. Although infection of control mice did not lead to detectable clinical illness, H8 mice started showing signs of wasting 6-8 d after
infection and between 20-40% (up to 100% if the experiments were done under non-specific pathogen-free conditions) died within 12-15 d after infection. The remaining mice continued to lose weight and all of them died 3-5 mo
after infection.
Histological examination of the recipient mice 35 d after
infection revealed profound alterations in splenic architecture and cellular composition in H8 mice compared to littermate controls. Macroscopically, the spleen was small and
had a fibrotic appearance, the follicular structure was
largely dissolved and almost all B cells, CD4 cells, FDCs,
and marginal zone macrophages were absent (Fig. 3; Table
1, experiment B). Total spleen cell counts were reduced
20-50-fold and CD8+ T cells were the only cell population demonstrable at significant numbers; ~90% of them
carried the transgenic, gp 33-specific TCR. Kinetic studies
showed that this splenic immunopathology was already prominent 12 d after infection and persisted for at least 60 d, which was the latest time point analyzed (Fig. 4). Interestingly, after infection of H8 mice transfused with perforin-deficient TCR318-Pfptm cells, the elimination of B cells
was as pronounced (Table 1, experiment D) and the histological alterations similar (not shown), but the outcome was
not lethal.

View larger version (163K):
[in this window]
[in a new window]
|
Fig. 3.
Virus-induced host-specific CD8+ T cells mediate GVH-like immunopathology. H8 and littermate control mice were transfused with 106
spleen cells from TCR318 mice and infected with 200 PFU LCMV 1 d later. At different time points after infection, tissue sections of spleen (d35), gut,
and liver (d50, separate experiment) were stained with hematoxilin-eosin (HE) or with Abs of the desired specificity. B220, CD45R+ B cells; CD4,
CD4+ T cells (YTS-191); CD8, CD8+ T cells (YTS-169); MOMA, marginal metallophilic macrophages; 4C11, FDCs.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 4.
Kinetics of splenic immunopathology mediated by virus-induced host-specific CD8+ T
cells. H8 and littermate control
(B6) mice were transfused with
106 spleen cells from TCR318
mice and infected with 200 PFU
LCMV 1 d later. At the indicated time points after transfer,
mice were killed and the absolute
number of B cells per spleen was
determined by flow cytometry.
|
|
CD8+ T cell infiltrations were also observed in other
target organs of GVH reactions such as liver, gut, and skin
(Fig. 3). Tissue destruction was limited, however, and neither lead to prolonged elevation of liver enzymes nor to
extensive eczemematous lesions of the skin. Finally, bone
marrow and peripheral blood counts were significantly altered in infected H8 mice compared to negative littermate
controls; bone marrow cellularity was reduced by a factor
of 2-5. Peripheral white cell counts were reduced by a factor of 5, and red cell counts were similar, but reticulocyte counts were reduced by a factor of 10 and thrombocyte
counts were reduced twofold. There were no obvious signs
of bleeding, however, and it is unclear whether these signs
of pathology alone can explain the acute deaths.
The clinical course described above showed that LCMV
infection not only interfered with the induction of CD8+
T cell tolerance by host tissue, but instead caused severe
immunopathology. Numeric and functional analysis of the
host-specific TCR transgenic CD8+ T cells revealed that
this was paralleled by their extensive proliferation (Fig. 5 a)
and the generation of donor-derived (gp 33)-specific cytotoxicity (Fig. 5 b) 8 d after infection. The TCR318 T cells
then returned to memory levels in transgene negative control mice (28), but remained at high levels (up to 90% of all
CD8+ T cells) in H8 mice for the observation period of 60 d
(Fig. 5 b).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 5.
Virus infection interferes with peripheral tolerance induction
and activates host-specific CD8+ T cells. H8 and littermate control (B6)
mice were transfused with 106 spleen cells from TCR318 mice. 3 d later,
the recipient mice were infected with 200 PFU LCMV-WE and the percentage of CD8+ PBLs expressing the transgenic V and V chains was
monitored by flow cytometric analysis (a). 8 d after challenge infection, spleen cells from some recipient mice were tested for gp 33-specific cytotoxicity on EL-4 target cells in a 5-h 51Cr-release assay; spontaneous release was <18% (b). Data from one of four similar experiments are shown.
|
|
Anergy of Persisting Host-specific CD8+ T Cells in H8
Mice.
In the following experiments, the persisting gp 33-
specific CD8+ T cells were characterized phenotypically
and functionally. Flow cytometric analysis of spleen cells of
H8 mice 30 d after virus infection revealed an activated
phenotype of the transferred TCR318 CD8+ T cells when
compared to littermate controls. The transgenic TCR-
and -
chains were downregulated about four to fivefold (Fig. 6, a and b); the cells had increased forward scatter (Fig. 6 c) and expressed higher levels of CD49d (Fig. 6 d), which
has been characterized as a useful marker to discriminate
between acutely activated versus memory cells (28). Note
that host CD8+ T cells carrying endogenous TCR chains
had mostly been eliminated (Fig. 6, a and b). In strong contrast to these phenotypic signs of activation, functional
analysis revealed little in vivo or in vitro activity of these
cells. Restimulation in vitro with or without addition of
Con A supernatant did not lead to generation of gp 33-
specific cytotoxicity (Fig. 6 e). Similarly, the proliferative response to gp 33-pulsed spleen stimulator cells was
strongly reduced and could not be recovered by the addition of Con A supernatant (Fig. 6 f). Finally, antiviral activity in vivo was ineffective since LCMV persisted in several
organs of H8 mice 35 d after infection, whereas virus was
readily controlled in littermate controls (Fig. 6 g). This was
not due to the generation of CTL escape mutants as
LCMV isolated from H8 mice 35 d after infection was well
recognized by gp 33-stimulated transgenic effector cells in
vitro as assessed by a 51Cr-release assay (data not shown).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 6.
Anergy of persisting virus-induced host-specific CD8+ T cells. (a-d) Phenotypical analysis of TCR318 T cells: H8 and littermate control
(B6) mice were transfused with 106 spleen cells from TCR318 mice and infected with 200 PFU LCMV-WE 3 d later. 35 d after infection, CD8+ spleen
cells of recipient mice were analyzed for expression of the transgenic V and V chains (a and b). Forward light scatter of V 2+V 8+CD8+ TCR318 T
cells (c) and CD49d expression of V 2+ CD8+ T cells (d) were compared between H8 (bold lines) and littermate mice (dashed lines). (e-g) Functional analysis of TCR318 T cells. 35 d after LCMV infection, spleen cells of H8 and littermate control (B6) mice were (e) tested for gp 33-specific cytotoxicity after 5 d of restimulation on LCMV-infected macrophages in the presence of 5% Con A supernatant and ( f ) used as responder cells in a [3H]thymidine incorporation assay stimulated by C57BL/6 spleen cells pulsed with gp 33-41. In experiment g, the LCMV virus titer was analyzed in the indicated organs
of the recipient mice. Data from one of two to four similar experiments are shown.
|
|
Role of Bone Marrow-derived Cells in the Induction of CTL-mediated Immunopathology.
To address the question of
which type of APC is involved in the observed activation
of host-specific T cells in the context of an infection, we
studied activation of CD8+ T cells and immunopathology
in bone marrow chimeric mice. Infection of H8-B6 chimeras 3 d after transfer of 106 TCR318 cells showed that
antigen exclusively expressed on bone marrow-derived
cells is sufficient for the induction of T cell proliferation
(Fig. 7 a), the generation of host-specific cytolytic activity
(Fig. 7 b), and subsequent lethal immunopathology. It was
also sufficient for the maintenance of a high number of anergic T cells in the chronic phase. Most of these features,
including acute lethal immunopathology, were also observed in the B6-H8 chimeras (Fig. 7, a and b) where the
specific antigen is largely expressed on non-bone marrow-
derived cells. An exception was the maintenance of anergic
T cells in the peripheral circulation, and to a lesser extent,
in the spleen.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 7.
Antigen presentation by bone marrow-derived versus epithelial cells for activation of host-specific CTLs. 6 wk after bone marrow
reconstitution, H8-B6 and B6-H8 bone marrow chimeras were transfused with 106 spleen cells from TCR318 mice. 3 d later, the recipient
mice were infected with 200 PFU LCMV-WE and the percentage of
CD8+ PBLs expressing the transgenic V and V chains was monitored by flow cytometric analysis (a). 8 d after challenge infection, spleen cells
from some recipient mice were tested for gp 33-specific cytotoxicity on
EL-4 target cells in a 5-h 51Cr-release assay; spontaneous release was
<18% (b). Deaths.
|
|
A Variety of Infectious and Inflammatory Stimuli Can Interfere
with Tolerance Induction.
Next, we investigated whether antigen-unrelated third-party infections are also able to abolish
tolerance induction and lead to activation and immunopathology in this model. H8 and littermate control mice transfused with 107 TCR318 spleen cells (corresponding to 106
TCR318 CD8+ T cells) were challenged with a variety of
different, completely unrelated pathogens. Infections with
vesicular stomatitis virus (VSV), vaccinia virus (to a minor
extent), and the intracellular bacterium Listeria monocytogenes all elicited a similar phenotype. This included expansion of TCR318 CD8+ T cells (Fig. 8 a), the generation of
gp 33-specific ex vivo cytotoxic activity (Fig. 8 c), and the
destruction of host lymphocytes (Fig. 8 d; Table 1). Interestingly, injection with 500 µg Poly:IC or 10 µg LPS also
induced activation (Fig. 8 b) and immunopathology (albeit
not acutely lethal) in H8 mice (Table 1, Fig. 8 d). Both infectious as well as inflammatory agents mediated their effect without involvement of T helper cells as depletion of
CD4+ T cells before infection did not change the observed
phenotype (Fig. 8 e).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 8.
Various infectious and inflammatory stimuli can interfere with tolerance induction and activate host-specific CD8+ T cells. H8 (closed symbols) and littermate control mice (open symbols) were transfused with 107 spleen cells from TCR318 mice and 1 d later injected with 500 µg Poly:IC, 10 µg
LPS, 2 × 106 PFU VSV-Indiana, 2 × 106 PFU vaccinia WR, 200 PFU LCMV-WE 8.7, or 200 PFU LCMV-WE. The percentage of CD8+ PBLs expressing the transgenic V and V chains was monitored by flow cytometry (a, b, e, and f ). 8 d after challenge infection, spleen cells from some recipient
mice were tested for gp 33-specific cytotoxicity on EL-4 target cells in a 5-h 51Cr-release assay (c). 20 d after infection, mice were killed and the absolute
number of B cells per spleen was determined by flow cytometry (d ). In experiment e, mice were depleted of CD4+ T cells 3 and 1 d before cell transfer.
In experiment f, the number of transferred TCR318 spleen cells was varied as indicated and mice were infected either with LCMV-WE (closed symbols) or with LCMV-WE 8.7 (open symbols).
|
|
Initial experiments had indicated that tenfold more (i.e.,
107) TCR318 spleen cells had to be transferred to elicit the
described phenotype with antigen-unrelated third-party
pathogens, when compared to infection with the specific
LCMV. To evaluate, whether this was due to particular
properties of LCMV infection or due to the fact that
LCMV-WE introduces the specific gp 33 epitope in a different context, we infected H8 mice transfused with different amounts of TCR318 spleen cells with LCMV-WE or
with the LCMV-WE 8.7 escape mutant, which is not recognized by the transgenic TCR. Fig. 8 f shows that 100-fold more TCR318 CD8+ T cells were required for the
mutant virus to induce measurable proliferation, indicating
that introduction of the nominal antigen in the context of
the LCMV infection strongly enhanced the response to the
transgene encoded self-antigen.
 |
Discussion |
This study shows that antigen-unrelated viral and bacterial infections as well as proinflammatory agents such as
LPS and Poly:IC can influence the induction of peripheral
CD8+ T cell tolerance to a widely expressed self-antigen in
vivo. Importantly, these stimuli not only prevented establishment of tolerance, but instead enhanced activation of
cytolytic CD8+ effector T cells that subsequently caused
significant immunopathology.
Efficient induction of peripheral T cell tolerance after a
transient period of proliferation has been described previously in several systems using adoptive transfer of TCR
transgenic T cells into mice widely expressing their nominal antigen (9, 16, 33). Tolerance was found to be a
consequence of extensive proliferation and subsequent
clonal deletion, leaving a small T cell population in an anergic state; T cell anergy was reversible after transfer into an
antigen-free environment (6, 34). In the present experiments we found only limited activation and proliferation of
antigen-specific T cells, for which antigen expression on
bone marrow-derived cells was sufficient. This is similar to a recent study where antigen expression in the host was
more restricted due to the use of a tissue-specific promoter
(18). Differences in the extent of T cell proliferation observed in the present compared to previous studies may be
explained by differences in the TCR transgenic mice and
the use of nude (9) or scid (17) recipient mice to increase
sensitivity for the study of transferred T cells. The finding
that 12 d after transfer, TCR318 T cells could not be restimulated by infection with LCMV, even after transfer into antigen-free recipients (data not shown), suggests that
clonal deletion was mainly responsible for the tolerance induction observed. A contribution of anergy can, however,
not be formally excluded. Whatever the mechanism, our
data confirm that peripheral tolerization of potentially autoreactive T cells involves a period of transient activation
that is usually of little functional or immunopathological consequence.
A role for infectious agents in breaking peripheral T cell
tolerance has been documented in previous studies. Infection of mice expressing the LCMV glycoprotein in the
cells of the endocrine pancreas with LCMV leads to activation of LCMV-specific CTLs and to the induction of diabetes (1, 2). Also, infection with the nematode Nipostrongulus
brasiliensis has been reported to partially reverse staphylococcal enterotoxin
-induced anergy of CD4+ T cells as assessed by proliferation and the restoration of IL-4 production
(7, 35). While in these experiments established tolerance is
reversed, other experiments showed that some stimuli may
also abolish the induction of tolerance. It was originally reported by Claman more than 30 yr ago, that bacterial LPS
can interfere with induction of B cell unresponsiveness to
-globulin (12). Later studies showed that LPS also prevents the induction CD4+ T cell tolerance (36), a finding
that was recently extended to the induction of tolerance to
superantigens (15). Earlier reports had also documented
that interference with tolerance induction can lead to activation (13, 14).
This study shows that a variety of pathogens and proinflammatory agents such as LPS or Poly:IC can interfere
with the induction of peripheral CD8+ T cell tolerance to
widely expressed antigens. The most important aspect of
our findings is that this conversion from efficient tolerance
induction to immunity towards tissue antigens can lead to
significant CD8+ T cell-mediated immunopathology. Our
results emphasize the importance of the antigen-specific
component in this antihost immune reactivity. (a) In the
absence of the specific antigen, infections with VSV, Listeria, or vaccinia virus or treatment with Poly:IC or LPS did not lead to measurable LCMV-specific T cell activation
(transfer into C57BL/6 mice + antigen-unrelated infection), confirming that nonspecific "bystander activation" is
of low efficacy and limited biological consequence (37). (b)
In the absence of an infection, the transgene-encoded self-antigen efficiently tolerized the antigen-reactive CD8+ T
cells (transfer into H8 mice, no infection). (c) If, however, mice were infected in the presence of the specific antigen
(transfer into H8 mice + antigen-unrelated or antigen-specific infection), these infections were able to activate CTLs
specific for the transgene-encoded self-antigen that caused
immunopathology. The observed pathology was only partially mediated by perforin. Although activation of perforin-deficient gp 33-specific CD8+ T cells in H8 mice did
not lead to lethality (which is presumably a consequence of
target cell destruction outside lymphoid tissue), the CD8+
T cell-mediated destruction of lymphoid cells was almost
as pronounced as in mice transfused with perforin-competent cells. Whether this reflects cytotoxicity mediated by
CD95L (38, 39) or TNF-
(40, 41) remains to be tested.
Which parameters determine the conversion from tolerance to CTL-mediated immunopathology? Several factors
were evaluated. (a) The importance of localization and
quantity of the specific antigen (3) was well illustrated by
the comparison between the effects of infection with
LCMV-WE8.7 (carrying a mutated gp 33 epitope; reference 25) and the wild-type virus. Although these viruses do
not differ in their capacity to replicate and to induce costimulatory molecules or cytokines, 50-100-fold more TCR318 T cells had to be transferred to observe the described phenotype after infection with the mutant compared to the wild-type virus. Since wild-type virus introduces the specific antigen in addition the transgene encoded
peptide mainly into APCs, this illustrates the role of specificity and indicates the importance of antigen localization
and quantity for the outcome of antigen contact of CTLs.
(b) The role of the APC type required to present the host
antigen was studied in bone marrow chimera experiments, which clearly show that in the presence of an infection, antigen presentation by bone marrow-derived cells is sufficient to elicit the described phenotype. The important
question of whether antigen presentation by non-bone
marrow-derived epithelial cells is sufficient to induce CTL
activation could not be conclusively addressed in this experimental model. It is well known that lethal irradiation, as used in our study, spares some bone marrow-derived
cells, in particular dendritic cells. The reduced number of
chronically persisting antigen-specific CTLs in mice expressing the antigen mostly on non-bone marrow-derived
cells may be explained by the fact that the initiating inflammatory reaction is controlled faster due to the lack of significant lymphoid pathology in these mice. (c) Previous
studies have postulated that under certain conditions CD4+
T cells are important for changing CD8+ T cell tolerance
into activation (11). It has also been suggested that Th1s
may promote CD8+ T cell activation. In our model,
CD4+ T cells were completely dispensable for the induction of CTL-mediated immunopathology. (d) The fact that
the proinflammatory substances Poly:IC or LPS could elicit
the same effect as viral or bacterial infections indicates that
a replicating pathogen is not required for antigen-specific
CTL activation under the conditions studied. The effects of
Poly:IC and LPS are severalfold. A previous study showed
that interference with superantigen-induced deletion was not mediated by the induction of the costimulatory molecule B7 on APCs (42); this remains, however, an untested
possibility. All infectious and proinflammatory agents used
have in common that they induce the secretion of various
cytokines. In this context, two recent studies have shown
that both Poly:IC and LPS can act indirectly on CD8+ T
cell proliferation, presumably by stimulation of type I interferon production by APCs (43). Several other redundant
cytokine pathways are conceivable including IL-1, IL-2,
IL-12, TNF, and IFN-
(15, 44). Whatever the precise
molecular mechanism, it is important to note that for a
CD8+, T cell encounter of antigen is not sufficient, even if
it is presented on a "professional" APC. Under in vivo conditions, the inflammatory milieu is necessary to convert this
encounter into an immunogenic, activating signal.
Some of the immunopathological consequences of infection observed in this study are reminiscent of alterations
characteristic of GVH reactions (GVHRs; reference 45). An
impact of infectious agents on the exacerbation of GVHRs
was demonstrated more than 20 yr ago (20) and enhancement of donor antihost reactivity has been documented in
humans and animal models after the infection with CMV
(46, 47) and, interestingly, also after the administration of
endotoxin (48) or Poly:IC (49). Although the experimental setup (involving the transfusion of TCR transgenic donor
spleen cells) and the fact that there was comparatively mild
pathology outside lymphoid tissue renders an analogy of
our model to this clinical condition rather limited, some of
our findings may illustrate principles relevant for activation
of host-specific T cells during GVHRs; CD8+ T cell-mediated antihost reactivity can be induced by a variety of bacterial and viral infectious agents. This does probably not involve activation of specific T cells cross-reactive to tissue antigens (50, 51) or nonspecific bystander activation (37, 43). As demonstrated in this study, activation is crucially dependent on the presence of the specific antigen. Infections may then provide an environment that interferes with
the induction of tolerance and instead promotes activation
of cytolytic CD8+ T cells to a sufficient extent to cause extensive GVHRs.
Received for publication 25 September 1997 and in revised form 1 December 1997.
We thank Karin Riem for excellent technical assistance.
| 1.
|
Ohashi, P.S.,
S. Oehen,
K. Buerki,
H. Pircher,
C.T. Ohashi,
B. Odermatt,
B. Malissen,
R.M. Zinkernagel, and
H. Hengartner.
1991.
Ablation of "tolerance" and induction of diabetes by virus infection in viral antigen transgenic mice.
Cell.
65:
305-317
[Medline].
|
| 2.
|
Oldstone, M.B.,
M. Nerenberg,
P. Southern,
J. Price, and
H. Lewicki.
1991.
Virus infection triggers insulin-dependent diabetes mellitus in a transgenic model: role of anti-self (virus)
immune response.
Cell.
65:
319-331
[Medline].
|
| 3.
|
Zinkernagel, R.,
S. Ehl,
P. Aichele,
S. Oehen,
T. Kundig, and
H. Hengartner.
1997.
Antigen localization regulates immune responses in a dose- and time-dependent fashion: a
geographical view of immune reactivity.
Immunol. Rev.
156:
199-209
[Medline].
|
| 4.
|
Schonrich, G.,
U. Kalinke,
F. Momburg,
M. Malissen,
V.A. Schmitt,
B. Malissen,
G.J. Hammerling, and
B. Arnold.
1991.
Down-regulation of T cell receptors on self-reactive T cells
as a novel mechanism for extrathymic tolerance induction.
Cell.
65:
293-304
[Medline].
|
| 5.
|
Schwartz, R.H..
1990.
A cell culture model for T lymphocyte clonal anergy.
Science.
248:
1349-1356
[Abstract/Free Full Text].
|
| 6.
|
Rocha, B.,
C. Tanchot, and
B.H. von Boehmer.
1993.
Clonal anergy blocks in vivo growth of mature T cells and
can be reversed in the absence of antigen.
J. Exp. Med.
177:
1517-1521
[Abstract/Free Full Text].
|
| 7.
|
Rocken, M.,
J.F. Urban, and
E.M. Shevach.
1992.
Infection breaks T-cell tolerance.
Nature.
359:
79-82
[Medline].
|
| 8.
|
Webb, S.,
C. Morris, and
J. Sprent.
1990.
Extrathymic tolerance of mature T cells: clonal elimination as a consequence of
immunity.
Cell.
63:
1249-1256
[Medline].
|
| 9.
|
Rocha, B., and
B.H. von Boehmer.
1991.
Peripheral selection of the T cell repertoire.
Science.
251:
1225-1228
[Abstract/Free Full Text].
|
| 10.
|
Moskophidis, D.,
F. Lechner,
H. Pircher, and
R.M. Zinkernagel.
1993.
Virus persistence in acutely infected immunocompetent mice by exhaustion of antiviral cytotoxic effector
T cells.
Nature.
362:
758-761
[Medline].
|
| 11.
|
Guerder, S., and
P. Matzinger.
1992.
A fail-safe mechanism
for maintaining self-tolerance.
J. Exp. Med.
176:
553-564
[Abstract/Free Full Text].
|
| 12.
|
Claman, H.N..
1963.
Tolerance to a protein antigen in adult
mice and the effect of non-specific factors.
J. Immunol.
91:
833-841
.
|
| 13.
|
Louis, J.A.,
J.M. Chiller, and
W.O. Weigle.
1973.
The ability
of bacterial lipopolysaccharide to modulate the induction of
unresponsiveness to a state of immunity. Cellular parameters.
J. Exp. Med.
138:
1481-1495
[Abstract].
|
| 14.
|
Parks, D.E.,
S.M. Walker, and
W.O. Weigle.
1981.
Bacterial lipopolysaccharide (endotoxin) interferes with the induction
of tolerance and primes thymus-derived lymphocytes.
J. Immunol.
126:
938-942
[Abstract].
|
| 15.
|
Vella, A.T.,
J.E. McCormack,
P.S. Linsley,
J.W. Kappler, and
P. Marrack.
1995.
Lipopolysaccharide interferes with the induction of peripheral T cell death.
Immunity.
2:
261-270
[Medline].
|
| 16.
|
Bertolino, P.,
W.R. Heath,
C.L. Hardy,
G. Morahan, and
J.F. Miller.
1995.
Peripheral deletion of autoreactive CD8+
T cells in transgenic mice expressing H-2Kb in the liver.
Eur. J. Immunol.
25:
1932-1942
[Medline].
|
| 17.
|
Zhang, L..
1996.
The fate of adoptively transferred antigen-specific T cells in vivo.
Eur. J. Immunol.
26:
2208-2214
[Medline].
|
| 18.
|
Kurts, C.,
W.R. Heath,
F.R. Carbone,
J. Allison,
J.F. Miller, and
H. Kosaka.
1996.
Constitutive class I-restricted exogenous presentation of self antigens in vivo.
J. Exp. Med.
184:
923-930
[Abstract/Free Full Text].
|
| 19.
|
Billingham, R.E..
1966.
The biology of graft-versus-host reactions.
Harvey Lect.
62:
21-78
[Medline].
|
| 20.
|
van Bekkum, D.,
J. Roodenburg,
P. Heidt, and
D. van der
Waaij.
1974.
Mitigation of secondary disease of allogeneic
mouse radiation chimeras by modification of the intestinal
microflora.
J. Natl. Cancer Inst.
52:
401-404
.
|
| 21.
|
Pircher, H.,
T.W. Mak,
R. Lang,
W. Ballhausen,
E. Ruedi,
H. Hengartner,
R.M. Zinkernagel, and
K. Burki.
1989.
T cell tolerance to Mlsa encoded antigens in T cell receptor V
beta 8.1 chain transgenic mice.
EMBO (Eur. Mol. Biol. Organ.) J.
8:
719-727
[Medline].
|
| 22.
|
Kagi, D.,
B. Ledermann,
K. Burki,
P. Seiler,
B. Odermatt,
K.J. Olsen,
E.R. Podack,
R.M. Zinkernagel, and
H. Hengartner.
1994.
Cytotoxicity mediated by T cells and natural
killer cells is greatly impaired in perforin-deficient mice.
Nature.
369:
31-37
[Medline].
|
| 23.
|
Mombaerts, P.,
J. Jaconini,
R. Johnson,
K. Herrup,
S. Tonegawa, and
V. Papaiounou.
1992.
RAG-1 deficient mice have
no mature B and T lymphocytes.
Cell.
68:
869-877
[Medline].
|
| 24.
|
Cobbold, S.P.,
A. Jayasuriya,
A. Nash,
T.D. Prospero, and
H. Waldmann.
1984.
Therapy with monoclonal antibodies by
elimination of T-cell subsets in vivo.
Nature.
312:
548-551
[Medline].
|
| 25.
|
Pircher, H.,
D. Moskophidis,
U. Rohrer,
K. Burki,
H. Hengartner, and
R.M. Zinkernagel.
1990.
Viral escape by selection of cytotoxic T cell-resistant virus variants in vivo.
Nature.
346:
629-633
[Medline].
|
| 26.
|
Battegay, M.,
S. Cooper,
A. Althage,
J. Banziger,
H. Hengartner, and
R.M. Zinkernagel.
1991.
Quantification of lymphocytic choriomeningitis virus with an immunological focus assay in 24- or 96-well plates.
J. Virol. Methods.
33:
191-198
[Medline].
|
| 27.
|
Fehr, T.,
G. Schoedon,
B. Odermatt,
T. Holtschke,
M. Schneemann,
M. Bachmann,
T. Mak,
I. Horak, and
R.M. Zinkernagel.
1997.
Crucial role of interferon consensus sequence binding protein, but neither of interferon regulatory
factor 1 nor of nitric oxide synthesis for protection against
murine listeriosis.
J. Exp. Med.
185:
921-931
[Abstract/Free Full Text].
|
| 28.
|
Zimmerman, C.,
R.K. Brduscha,
C. Blaser,
R.M. Zinkernagel, and
H. Pircher.
1996.
Visualization, characterization, and
turnover of CD8+ memory T cells in virus-infected hosts.
J.
Exp. Med.
183:
1367-1375
[Abstract/Free Full Text].
|
| 29.
|
Zinkernagel, R.M.,
T. Leist,
H. Hengartner, and
A. Althage.
1985.
Susceptibility to lymphocytic choriomeningitis virus
isolates correlates directly with early and high cytotoxic T cell
activity, as well as with footpad swelling reaction, and all
three are regulated by H-2D.
J. Exp. Med.
162:
2125-2141
[Abstract/Free Full Text].
|
| 30.
|
Aichele, P.,
K. Brduscha-Riem,
S. Oehen,
B. Odermatt,
R. Zinkernagel,
H. Hengartner, and
H. Pircher.
1997.
Peptide-antigen treatment of virus-immune mice: antigen-specific tolerance versus immunopathology.
Immunity.
6:
519-528
[Medline].
|
| 31.
|
Gray, D.,
M. Kosco, and
B. Stockinger.
1991.
Novel pathways of antigen presentation for the maintenance of memory.
Int. Immunol.
3:
141-148
[Abstract/Free Full Text].
|
| 32.
|
Binder, D.,
J. Fehr,
H. Hengartner, and
R. Zinkernagel.
1997.
Virus-induced transient bone marrow aplasia: major
role of interferon- / during acute infection with the noncytopathic lymphocytic choriomeningitis virus.
J. Exp. Med.
185:
517-530
[Abstract/Free Full Text].
|
| 33.
|
Rocha, B.,
A. Grandien, and
A.A. Freitas.
1995.
Anergy and
exhaustion are independent mechanisms of peripheral T cell tolerance.
J. Exp. Med.
181:
993-1003
[Abstract/Free Full Text].
|
| 34.
|
Alferink, J.,
B. Schittek,
G. Schonrich,
G.J. Hammerling, and
B. Arnold.
1995.
Long life span of tolerant T cells and the
role of antigen in maintenance of peripheral tolerance.
Int. Immunol.
7:
331-336
[Abstract/Free Full Text].
|
| 35.
|
Rocken, M.,
J. Urban, and
E.M. Shevach.
1994.
Antigen-specific activation, tolerization, and reactivation of the interleukin 4 pathway in vivo.
J. Exp. Med.
179:
1885-1893
[Abstract/Free Full Text].
|
| 36.
|
Chiller, J.M., and
W.O. Weigle.
1973.
Termination of tolerance to human gamma globulin in mice by antigen and bacterial lipopolysaccharide (endotoxin).
J. Exp. Med.
137:
740-750
[Abstract].
|
| 37.
|
Ehl, S.,
J. Hombach,
P. Aichele,
H. Hengartner, and
R.M. Zinkernagel.
1997.
Bystander activation of cytotoxic T cells:
studies on the mechanism and evaluation of in vivo significance in a transgenic mouse model.
J. Exp. Med.
185:
1241-1251
[Abstract/Free Full Text].
|
| 38.
|
Baker, M.,
N. Altman,
E. Podack, and
R. Levy.
1996.
The role of cell-mediated cytotoxicity in acute GVHD after
MHC-matched allogeneic bone marrow transplantation in
mice.
J. Exp. Med.
183:
2645-2656
[Abstract/Free Full Text].
|
| 39.
|
Braun, M.,
B. Lowin,
L. French,
H. Acha-Orbea, and
J. Tschopp.
1996.
Cytotoxic T cells deficient in both functional
Fas ligand and perforin show residual cytolytic activity yet
lose their capacity to induce lethal acute graft-versus-host disease.
J. Exp. Med.
183:
657-661
[Abstract/Free Full Text].
|
| 40.
|
Piguet, P.,
B. Grau,
B. Allet, and
P. Vassalli.
1987.
Tumor necrosis factor/cachectin is an effector of skin and gut lesions in the acute phase of graft-versus-host disease.
J. Exp. Med.
166:
1280-1289
[Abstract/Free Full Text].
|
| 41.
|
Speiser, D.,
M. Bachmann,
T. Frick,
K. McKall-Faienza,
E. Griffiths,
K. Pfeffer,
T. Mak, and
P. Ohashi.
1997.
TNF receptor p55 controls early acute graft-versus-host disease.
J. Immunol.
158:
5185-5190
[Abstract].
|
| 42.
|
Vella, A.T.,
T. Mitchell,
B. Groth,
P.S. Linsley,
J.M. Green,
C.B. Thompson,
J.W. Kappler, and
P. Marrack.
1997.
CD28 engagement and proinflammatory cytokines contribute to T
cell expansion and long-term survival in vivo.
J. Immunol.
158:
4714-4720
[Abstract].
|
| 43.
|
Tough, D.F.,
P. Borrow, and
J. Sprent.
1996.
Induction of
bystander T cell proliferation by viruses and type I interferon in vivo.
Science.
272:
1947-1950
[Abstract].
|
| 44.
|
Weigle, W.O.,
W.V. Scheuer,
M.V. Hobbs,
E.L. Morgan, and
D.E. Parks.
1987.
Modulation of the induction and circumvention of immunological tolerance to human gamma-globulin by interleukin 1.
J. Immunol.
138:
2069-2074
[Abstract].
|
| 45.
|
Rappaport, H.,
A. Khalil,
P.O. Halle,
L. Pritchard,
D. Dantchev, and
G. Mathe.
1979.
Histopathologic sequence of events
in adult mice undergoing lethal graft-versus-host reaction developed across H-2 and/or non-H-2 histocompatibility barriers.
Am. J. Pathol.
96:
121-142
[Abstract].
|
| 46.
|
Grundy, J.E.,
J.D. Shanley, and
G.M. Shearer.
1985.
Augmentation of graft-versus-host reaction by cytomegalovirus
infection resulting in interstitial pneumonitis.
Transplantation.
39:
548-553
[Medline].
|
| 47.
|
Lonnqvist, B.,
O. Ringden,
B. Wahren,
G. Gahrton, and
G. Lundgren.
1984.
Cytomegalovirus infection associated with
and preceding chronic graft-versus-host disease.
Transplantation.
38:
465-468
[Medline].
|
| 48.
|
Howard, J..
1961.
Increased sensitivity to bacterial endotoxin
of F1 hybrid mice undergoing graft-versus-host reaction.
Nature.
190:
1122
[Medline].
|
| 49.
|
Peres, A.,
S. Amlani,
M. Kornbluth,
T.A. Seemayer, and
W.S. Lapp.
1989.
The effects of polyinosinic:polycytidylic
acid on the graft-versus-host reaction. III. Increased severity
of the reaction with delayed pI:C treatment.
Transplantation.
48:
80-84
[Medline].
|
| 50.
|
Yang, H., and
R.M. Welsh.
1986.
Induction of alloreactive
cytotoxic T cells by acute virus infection of mice.
J. Immunol.
136:
1186-1193
[Abstract].
|
| 51.
|
Yang, H.Y.,
P.L. Dundon,
S.R. Nahill, and
R.M. Welsh.
1989.
Virus-induced polyclonal cytotoxic T lymphocyte
stimulation.
J. Immunol.
142:
1710-1718
[Abstract].
|