|
|
|
|
|
|
|
||
upon
Combined Stimulation with Interleukin (IL)-12 and IL-18:
A Novel Pathway of Autocrine Macrophage Activation
By
From the Max-Planck-Institut für Immunbiologie, D-79108 Freiburg, Germany
 |
Abstract |
|---|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Interferon (IFN)-
, a key immunoregulatory cytokine, has been thought to be produced solely
by activated T cells and natural killer cells. In this study, we show that murine bone marrow- derived macrophages (BMM
) secrete large amounts of IFN- upon appropriate stimulation.
Although interleukin (IL)-12 and IL-18 alone induce low levels of IFN- mRNA transcripts,
the combined stimulation of BMM with both cytokines leads to the efficient production of
IFN- protein. The macrophage-derived IFN- is biologically active as shown by induction of
inducible nitric oxide synthase as well as upregulation of CD40 in macrophages. Our findings
uncover a novel pathway of autocrine macrophage activation by demonstrating that the macrophage is not only a key cell type responding to IFN- but also a potent IFN--producing
cell.
;
interleukin 12;
interleukin 18;
innate immunity
| |
Introduction |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Interferon (IFN)- regulates a variety of important immunological programs. It is the predominant cytokine
during Th1-dominated immune reactions, participates importantly during antigen presentation, and is the prototypical macrophage-activating cytokine. Consequently, a pivotal role of IFN- in the clearance of various intracellular pathogens has been amply demonstrated (1). One of the
key events during innate immune reactions is the production of IL-12 mainly by macrophages (2). IL-12 induces
NK cells to rapidly secrete IFN-, which then acts back to
activate macrophages early in an immune response. Furthermore, IL-12 induces IFN- production by T cells and
is the key cytokine driving Th1 cell differentiation.
A recently discovered novel cytokine, IL-18, shares many
functional properties with IL-12. IL-18 was described originally as a Kupffer cell-derived costimulating factor essential for the production of IFN- in a murine LPS-induced
shock model (3). IL-18 has been cloned recently (4), and
was shown subsequently to induce IFN- in human (5)
and murine (6) T cells. Moreover, strong synergistic effects
between IL-12 and IL-18 in the induction of IFN- secretion of T cells (5, 6) or NK cells (7) were described.
A few reports described the secretion of low levels of
IFN- by murine (8, 9) or human (10) macrophages stimulated with IFN- itself (8), IL-12 (9), or Mycobacterium tuberculosis (10). Because these findings are at variance with
the widely accepted view that T cells and NK cells are the
sole producers of IFN-, the general significance of these
observations remained uncertain. A recent report demonstrated the secretion of IFN- even by B cells upon combined stimulation with IL-12 and IL-18 (11). In this study,
we demonstrate that these two cytokines synergistically induce macrophages to secrete large amounts of IFN-
which is biologically active in an autocrine fashion. The data suggest that macrophage activation may operate by an
autocrine positive feedback loop involving multiple cytokines, including IFN-.
| |
Materials and Methods |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Medium and Reagents.
All cell culture was performed in DMEM supplemented with 10% heat-inactivated FCS, 2 mM L-glutamine, 60 µM 2-mercaptoethanol, 1 mM sodium pyruvate, 1× nonessential amino acids, 100 U/ml penicillin, and 100 µg/ml streptomycin (GIBCO BRL, Paisley, UK). Recombinant murine IFN- was obtained from Genentech
Inc. (South San Francisco, CA), IL-12 was purchased from R&D
Systems (Abingdon, UK), and IL-18 and TNF-
from PeproTech, Inc. (London, UK). Biotinylated anti-CD40 (clone 3/23)
and rIgG2a isotype control antibodies were obtained from
PharMingen (San Diego, CA). Streptavidin-PE was purchased
from GIBCO BRL.
Animals and Generation of Bone Marrow-derived Macrophages.
Mice of strains AKR/N, C57BL/6, and 129Sv and mice homozygous for a targeted mutation of the IFN- receptor (IFN-R
/; 129Sv) (12) were obtained from the specific pathogen-
free animal facilities of the Max-Planck-Institut and were used
between 6 and 8 wk of age.
Macrophages were derived from bone marrow cells (BMM)
as described previously (12).
IFN- Assay, Nitric Oxide Measurement, and Analysis of CD40
Expression by FACS®.
was determined by a commercially available (PharMingen) sandwich ELISA test according to
the manufacturer's protocol. The measuring range of the ELISA
test was 0.5-100 ng/ml. Nitric oxide (NO) was measured as nitrite using the Griess reagent as described previously (13).
To assess CD40 expression by FACS®, 2 ×105 BMM were
preincubated with FcBlockTM (PharMingen) and stained with biotinylated anti-CD40 mAb or isotype control (biotin rIgG2a) for
30 min on ice. After another wash step, cells were stained with
Streptavidin-PE for 30 min on ice and subsequently analyzed on a
FACScan® (Becton Dickinson, Mountain View, CA), gating on
viable cells by propidium iodide counterstaining. All washing and
staining steps were performed in PBS/2% FCS.
Reverse Transcription PCR.
5 × 106 BMM were seeded and
stimulated in 55-mm Petriperm® hydrophob Petri dishes (Heraeus
GmbH, Hanau, Germany) in a final volume of 5 ml. At the indicated time points, cells were harvested with a rubber policeman,
and total cellular RNA was prepared by the method of Chomczynski and Sacchi (14). Reverse transcription was performed by
standard procedures using Moloney murine leukemia virus reverse transcriptase (Pharmacia GmbH, Freiburg, Germany).
0.01-1 µl of the resulting cDNA (adjusted to a concentration
of 50 ng/µl input RNA) was then amplified by PCR (annealing
temperature 58°C, 1.5 mM MgCl2) for 35 cycles. The sequences
for the primers used are as follows: 
-actin sense primer, 5' TGGAATCCTGTGGCATCCAT GAAAC 3', and -actin antisense primer, 5' TAAAACGCAGCTCAGTAACAGTCCG 3',
generating a 348-bp PCR product; and IFN- sense primer, 5' GCTCTGAGACAATGAACGCT 3', and IFN- antisense
primer, 5' AAAGAGATAATCTGGCTCTGC 3', generating a
227-bp PCR product. The PCR products were run on a 1.5%
agarose gel and visualized by ethidium bromide staining.
RNA In Situ Hybridization.
In situ hybridization was performed using a digoxigenin-labeled riboprobe corresponding to the region between nucleotides 371 and 1075 of the mouse IFN- cDNA,
using a protocol modified from Vignaud et al. (15). In brief, BMM
were cultured on glass chamber slides (Nunc, Inc., Naperville, IL),
washed in PBS, fixed in 4% paraformaldehyde for 3 min, permeabilized in 100 mM glycine for 20 min, followed by a short wash
in water, and postfixed in 4% paraformaldehyde for 5 min. The
cells were then hybridized overnight at 55°C with 1 µg/ml of
the riboprobe in 40% formamide, 5× SSC, 1× Denhardt's, 100 µg/ml denatured herring sperm DNA, and 100 µg/ml tRNA. After
extensive washing in 2× SSC, 50% formamide at 50°C, unspecific
antibody binding was blocked by incubation at room temperature
for 1 h in TBS (25 mM Tris-HCl, pH 7.5, 140 mM NaCl, 2.7 mM KCl) containing 10% sheep serum. Alkaline phosphatase-conjugated antidigoxigenin antibodies (Boehringer Mannheim, Mannheim, Germany) were then applied at 4°C for 5 h in TBS containing
1% sheep serum. The cells were then washed extensively in TBS,
equilibrated with 100 mM Tris-HCl, pH 9.5, 100 mM NaCl, 50 mM MgCl2, and the alkaline phosphatase activity was developed
with BCIP/NBT (Boehringer Mannheim) for 6 h. The preparations were mounted, and the cells were photographed under
Nomarski optics.
| |
Results |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
to Secrete Large Amounts
of IFN-.
AKR/N-BMM were stimulated with various
concentrations of IL-12 or IL-18 alone or in combination
(Fig. 1). At different time points, the IFN- concentrations in
the supernatants were determined by ELISA. The stimulation
of the macrophages with IL-12 or IL-18 alone did not result
in detectable IFN- secretion. In sharp contrast, both cytokines synergized strongly to induce readily detectable levels
of IFN- in the supernatants at all time points tested. The
cytokine accumulated from 3.7 ng/ml per 105 cells at 24 h
to 42 ng/ml per 105 cells IFN- at 96 h. Stimulation of the
macrophages with IL-12 and IL-18 at 96 h was still suboptimal, as a plateau of IFN- secretion has not been reached.
The induced levels of IFN- are comparable to those
reached upon anti-CD3 stimulation of the prototypical Th1 T cell clone AE7 (81 ng/ml per 105 cells, data not
shown). The ability of the macrophages to secrete IFN- is
not restricted to the AKR/N strain of mice. We also tested BMM of C57BL/6 (see also Fig. 3 A) and BALB/c (data
not shown) mice with similar results. To demonstrate the
purity of our BMM population and to exclude the possibility of contaminating NK, T, or B cells in our assay, we
analyzed the BMM by FACS®. The population was consistently found to be homogeneously positive for F4/80,
MAC-1, I-Ak, B7.1, and CD16/32. T cell antigens (CD3,
CD4, and CD8), NK cell marker (DX5, and also NK1.1
for C57BL/6 mice) or B cell antigens (B220, CD19, and
CD5) were uniformly negative (data not shown).
|
|
We also assayed the commonly used mouse macrophage
cell lines RAW 264.7, J774, RAW 309Cr, P388D1, and
IC 21. In contrast to BMM, none of the five cell lines
produced IFN- upon stimulation with IL-12 and IL-18
(data not shown).
mRNA in BMM.
T o
address the level of regulation of IFN- synthesis, we stimulated BMM with IL-12 (10 ng/ml) or IL-18 (50 ng/
ml), alone or in combination, and prepared mRNA after 2, 8, and 24 h of stimulation. IFN- mRNA expression was
then evaluated by reverse transcription (RT)-PCR (Fig. 2
A). In the case of BMM stimulated with IL-12 plus IL-18, a prominent band of IFN- mRNA appeared as early
as 2 h after addition of the cytokines, and increased further
at later time points after stimulation. The PCR product
was proven to result from IFN- mRNA by sequencing
(data not shown). Surprisingly, although no secreted IFN-
was detectable in the supernatant of BMM stimulated
with IL-12 alone or IL-18 alone, IFN- mRNA was clearly induced. This induction appears to be more prominent in the case of stimulation with IL-12 than with IL-18
and increases over time during the culture period. Nevertheless, as shown semiquantitatively by titrating the input
cDNA of the PCR reaction, the induction of IFN-
mRNA by combined stimulation with IL-12 and IL-18 is clearly far more efficient, consistent with the synergism observed at the protein level. To estimate the frequency of
IFN--producing macrophages within the whole population, we performed RNA in situ hybridization experiments
(Fig. 2, B and C). After 18 h of stimulation with IL-12 plus
IL-18, ~25-30% of the BMM stained strongly positive for IFN- mRNA (Fig. 2 C), whereas unstimulated control BMM were homogeneously negative (Fig. 2 B).
Control stainings with the riboprobe in sense orientation
also yielded completely negative results (data not shown).
|
.
To test the biological activity of IFN- produced
endogenously by BMM stimulated with IL-12 plus IL-18, we tested two different indicators of IFN--mediated
macrophage activation. First, IFN- is known to synergize
with TNF- in the induction of inducible NO synthase
(iNOS) with concomitant production of nitric oxide (NO)
in macrophages (16). Therefore, we stimulated BMM of
AKR/N and C57BL/6 mice with optimal concentrations
of IL-12, IL-18, or IL-12 plus IL-18 and titrated increasing
concentrations of TNF- into these cultures. Control cultures received IFN-. As a readout for iNOS induction,
we determined nitrite, the stable end product of NO, in
the supernatants after 96 h of stimulation (Fig. 3 A). IFN-
was measured simultaneously in the supernatants. In macrophages exposed to IL-12 plus IL-18, increasing concentrations of TNF- induced iNOS very efficiently, although
somewhat less than upon optimal stimulation with exogenously added IFN-. Experiments with mice lacking the
IFN- receptor (IFN-R/) proved that endogenously
produced IFN- is responsible for the induction of iNOS:
although IFN-R/-BMM stimulated with IL-12 plus
IL-18 plus TNF- secreted IFN- comparable to control
IFN-R+/+-BMM (129Sv), no nitrites were detectable
in the supernatant of the IFN-R/-BMM, reflecting a
failure of iNOS induction when IFN- is unable to signal
via its receptor (Fig. 3 B). Indeed, nitrite accumulation reflected iNOS induction, as demonstrated by the addition of
the iNOS inhibitor L-monomethyl-L-arginine, which completely abolished detectable nitrites without influencing
IFN- induction (data not shown).
Two additional interesting observations were consistently made. First, with increasing concentrations of TNF-,
IFN- levels stimulated with IL-12 plus IL-18 decrease
(Fig. 3, A and B). IFN-R/-BMM are an exception to
this rule (Fig. 3 B), pointing to a possible role of enhanced
consumption of IFN- upon increasing concentrations of
TNF-. The phenomenon is unrelated to the simultaneously produced NO, known to be potentially autotoxic
to the secreting macrophage itself (16), because L-monomethyl-L-arginine had no influence on the observed decrease of IFN- (data not shown). Second, in the case of
the C57BL/6-BMM (Fig. 3 A), IL-12 alone synergizes
with TNF- to induce IFN- as well as iNOS. In AKR/N mice, a different and/or less efficient synergism seems to
operate: in five independent experiments, a slight induction
of nitrites was noted consistently upon costimulation with
50 ng/ml TNF-, whereas IFN- in the supernatant was
either undetectable or only marginally elevated (e.g., 1.5 ng/ml in Fig. 3 A).
As a second system to demonstrate the functional potential
of the BMM-derived IFN-, we assayed the IFN--mediated upregulation of CD40. Resting BMM are negative
or only slightly positive for CD40, whereas stimulation
with IFN- for 48 h leads to an upregulation of this costimulatory molecule (M. Munder, unpublished observation). The same induction was noted on IFN-R+/+-BMM (129Sv) stimulated with IL-12 plus IL-18. Again,
endogenously produced IFN- was responsible for this effect, as demonstrated by the lack of CD40 induction on
IFN-R/-BMM stimulated with IL-12 plus IL-18
(Fig. 4). BMM of mice with 129 background are definitively less efficient in IFN- production upon IL-12/IL-18
stimulation (Fig. 3 B, and Fig. 4) than BMM of strains
AKR/N or C57BL/6 (Fig. 1, and Fig. 3 A). Nevertheless, even these lower amounts of induced IFN- clearly autoactivate the macrophages to upregulate iNOS and CD40.
|
| |
Discussion |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
These experiments were stimulated by the results of several authors showing synergism between IL-12 and IL-18
in the induction of IFN- by human (5) and murine (6) T
cells and murine NK cells (7). Remarkably, both cytokines
were shown recently to cooperatively induce IFN- secretion of murine B cells (11). We now extend these observations by demonstrating that macrophages become efficient
IFN--producing cells upon combined stimulation with
IL-12 and IL-18. The levels of IFN- were of a similar
magnitude as that produced by T cells, and we observe efficient autocrine macrophage activation by endogenously
generated IFN- in vitro.
We found that a considerable proportion but not all
BMM express IFN- mRNA under our conditions of in
vitro stimulation. Moreover, five established macrophage
cell lines failed to produce IFN- under these conditions.
A detailed comparison (17) of various IFN--induced activation parameters between immortalized macrophage cell
lines and ex vivo-derived peritoneal macrophages demonstrated that each immortalized cell line exhibited only a part of the spectrum of the determined activation markers,
whereas all were detected in normal macrophages. It is not
clear whether these and our findings reflect a genuine
quantitative or qualitative macrophage heterogeneity in the
response to cytokines, and/or a loss of functional potency
associated with prolonged tissue culture maintenance.
Although the combined stimulation of the BMM with
IL-12 and IL-18 is required to stimulate IFN- secretion,
both cytokines alone suffice in inducing detectable IFN-
mRNA. Whether this difference reflects merely a limitation of the ELISA sensitivity or hints towards unknown
posttranscriptional regulatory mechanisms remains to be
elucidated. Furthermore, Fultz et al. described the detection of IFN- mRNA without secreted protein upon LPS stimulation of various types of murine macrophages, including BMM (18), a finding we were unable to reproduce in the present study (not shown).
An interesting side-aspect of our work is the finding that
IL-12 and TNF-, similar to their synergistic effects in the
induction of IFN- by NK cells (19), also cooperate in the induction of IFN- secretion by BMM. Among the three
strains tested, this effect is seen only in C57BL/6-BMM,
possibly reflecting a genetic polymorphism related to the
known genetic differences between inbred mice in the
ability to generate Th1- or Th2-dominated immune responses. Thus, a detailed comparison of this phenomenon
between different mouse strains might prove fruitful.
Our work demonstrates for the first time that macrophages
secrete high levels of IFN- upon combined stimulation
with IL-12 and IL-18. Upon appropriate activation by pathogens or LPS, macrophages are known to be important producers of IL-12 (2) or IL-18 (3). Thus, our findings unravel
a novel potential pathway of autocrine macrophage activation involving endogenously produced IFN-. This pathway might play a pivotal role during early innate immune
reactions, i.e., before the development of adaptive immunity, in infectious diseases (7, 10), in septic shock (3), as
well as during autoimmune reactions (20).
| |
Footnotes |
|---|
Address correspondence to Manuel Modolell, Max-Planck-Institut für Immunbiologie, Stübeweg 51, D-79108 Freiburg, Germany. Phone: 49-761-5108-535; Fax: 49-761-5108-534; E-mail: modolell{at}immunbio.mpg.de
Received for publication 12 March 1998 and in revised form 6 April 1998.
| |
References |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. |
Boehm, U.,
T. Klamp,
M. Groot, and
J.C. Howard.
1997.
Cellular responses to interferon-.
Annu. Rev. Immunol.
15:
749-795
[Medline].
|
| 2. | Trinchieri, G.. 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu. Rev. Immunol. 13: 251-276 [Medline]. |
| 3. | Okamura, H., K. Nagata, T. Komatsu, T. Tanimoto, Y. Nukata, F. Tanabe, K. Akita, K. Torigoe, T. Okura, S. Fukuda, and M. Kurimoto. 1995. A novel costimulatory factor for gamma interferon induction found in the livers of mice causes endotoxic shock. Infect. Immun. 63: 3966-3972 [Abstract]. |
| 4. |
Okamura, H.,
H. Tsutsui,
T. Komatsu,
M. Yutsudo,
A. Hakura,
T. Tanimoto,
K. Torigoe,
T. Okura,
Y. Nukada,
K. Hattori, et al
.
1995.
Cloning of a new cytokine that induces
IFN- production by T cells.
Nature.
378:
88-91
[Medline].
|
| 5. |
Micallef, M.,
T. Ohtsuki,
K. Kohno,
F. Tanabe,
S. Ushio,
M. Namba,
T. Tanimoto,
K. Torigoe,
M. Fujii,
M. Ikeda, et al
.
1996.
Interferon--inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism
with interleukin-12 for interferon- production.
Eur. J. Immunol.
26:
1647-1651
[Medline].
|
| 6. |
Robinson, D.,
K. Shibuya,
A. Mui,
F. Zonin,
E. Murphy,
T. Sana,
S.B. Hartley,
S. Menon,
R. Kastelein,
F. Bazan, and
A. O'Garra.
1997.
IGIF does not drive TH1 development but
synergizes with IL-12 for interferon- production and activates IRAK and NF B.
Immunity.
7:
571-581
[Medline].
|
| 7. | Zhang, T.T., K. Kawakami, M.H. Qureshi, H. Okamura, M. Kurimoto, and A. Saito. 1997. Interleukin-12 (IL-12) and IL-18 synergistically induce the fungicidal activity of murine peritoneal exudate cells against Cryptococcus neoformans through production of gamma interferon by natural killer cells. Infect. Immun. 65: 3594-3599 [Abstract]. |
| 8. |
Di Marzio, P.,
P. Puddu,
L. Conti,
F. Belardelli, and
S. Gessani.
1994.
Interferon- upregulates its own gene expression
in mouse peritoneal macrophages.
J. Exp. Med.
179:
1731-1736
|
| 9. | Puddu, P., L. Fantuzzi, P. Borghi, B. Varano, G. Rainaldi, E. Guillemard, W. Malorni, P. Nicaise, S.F. Wolf, F. Belardelli, and S. Gessani. 1997. IL-12 induces IFN-gamma expression and secretion in mouse peritoneal macrophages. J. Immunol. 159: 3490-3497 [Abstract]. |
| 10. | Fenton, M.J., M.W. Vermeulen, S. Kim, M. Burdick, R.M. Strieter, and H. Kornfeld. 1997. Induction of gamma interferon production in human alveolar macrophages by Mycobacterium tuberculosis. Infect. Immun. 65: 5149-5156 [Abstract]. |
| 11. |
Yoshimoto, T.,
H. Okamura,
Y. Tagawa,
Y. Iwakura, and
K. Nakanishi.
1997.
Interleukin 18 together with interleukin 12 inhibits IgE production by induction of interferon- production from activated B cells.
Proc. Natl. Acad. Sci. USA.
94:
3948-3953
|
| 12. |
Huang, S.,
W. Hendriks,
A. Althage,
S. Hemmi,
H. Bluethmann,
R. Kamijo,
J. Vilcek,
R.M. Zinkernagel, and
M. Aguet.
1993.
Immune response in mice that lack the interferon- receptor.
Science.
259:
1742-1745
|
| 13. | Modolell, M., I.M. Corraliza, F. Link, G. Soler, and K. Eichmann. 1995. Reciprocal regulation of nitric oxide synthase/ arginase balance in mouse bone marrow-derived macrophages by TH1 and TH2 cytokines. Eur. J. Immunol. 25: 1101-1104 [Medline]. |
| 14. | Chomczynski, P., and L. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159 [Medline]. |
| 15. | Vignaud, J.M., N. Martinet, Y. Martinet, and F. Plenat. 1994. In situ hybridization for localization of mRNAs in mononuclear phagocytes in cell culture and tissue sections. J. Immunol. Methods. 174: 281-296 [Medline]. |
| 16. | MacMicking, J., Q.-W. Xie, and C. Nathan. 1997. Nitric oxide and macrophage function. Annu. Rev. Immunol. 15: 323-350 [Medline]. |
| 17. |
Lambert, L.E., and
D.M. Paulnock.
1989.
Differential induction of activation markers in macrophage cell lines by interferon-.
Cell. Immunol.
120:
401-418
[Medline].
|
| 18. |
Fultz, M.J.,
S.A. Barber,
C.W. Dieffenbach, and
S.N. Vogel.
1993.
Induction of IFN- in macrophages by lipopolysaccharide.
Int. Immunol.
5:
1383-1392
|
| 19. |
Tripp, C.,
S. Wolf, and
E.R. Unanue.
1993.
Interleukin 12 and tumor necrosis factor are costimulators of interferon-
production by natural killer cells in severe combined immunodeficiency mice with listeriosis, and interleukin 10 is a physiologic antagonist.
Proc. Natl. Acad. Sci. USA.
90:
3725-3729
|
| 20. | Rothe, H., N.A. Jenkins, N.G. Copeland, and H. Kolb. 1997. Active stage of autoimmune diabetes is associated with the expression of a novel cytokine, IGIF, which is located near Idd2. J. Clin. Invest. 99: 469-474 [Medline]. |
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
