Rearranged immunoglobulin variable genes are extensively mutated after stimulation of B lymphocytes by antigen. Mutations are likely generated by an error-prone DNA polymerase, and
the mismatch repair pathway may process the mispairs. To examine the role of the MSH2 mismatch repair protein in hypermutation, Msh2
/
mice were immunized with oxazolone, and B
cells were analyzed for mutation in their V
Ox1 light chain genes. The frequency of mutation
in the repair-deficient mice was similar to that in Msh2+/+ mice, showing that MSH2-dependent mismatch repair does not cause hypermutation. However, there was a striking bias for
mutations to occur at germline G and C nucleotides. The results suggest that the hypermutation pathway frequently mutates G·C pairs, and a MSH2-dependent pathway preferentially
corrects mismatches at G and C.
Key words:
 |
Introduction |
Hypermutation of immunoglobulin variable (V) genes
occurs in B lymphocytes after antigen stimulation.
Mutations are generated 1,000,000 times more frequently
in V genes than in other genes, which implies that the
mechanism that causes hypermutation is different than
those that generate spontaneous mutations. Furthermore, the hypermutation mechanism is unique because it introduces mutations into a small area on three chromosomes
that contain rearranged V, diversity, and joining (J) gene
segments for heavy,
, and
immunoglobulin chains (for
review see reference 1). A survey of the substitutions shows
that transitions are found twice as frequently as transversions; germline G, A, and C nucleotides on the coding
strand have an equal frequency of undergoing mutation, and T is mutated less frequently (2). Once mutations occur on the DNA strands, they would typically be substrates for
the mismatch repair pathway.
During semiconservative replication, mismatched base
pairs are recognized and corrected by several repair proteins. These proteins, MutS homologue 2 (MSH2)1, MSH3,
MSH6, post-meiotic segregation 2 (PMS2), and Mut L homolog 1 (MLH1), form a multiprotein complex that recognizes and excises mismatch errors (for review see reference
3). Once excised, DNA polymerases
or
resynthesize the
repair gap. There are several ways in which the mismatch
repair pathway could be involved in somatic hypermutation: (a) mismatch repair may actually cause the mutations
by processing heteroduplex secondary structures that could
form in the V region (4), (b) during occasional repair of
DNA damage, an error-prone DNA polymerase might introduce mismatches in the repair gap (5, 6); or (c) mismatch
repair might be actively suppressed in the V region, allowing normal replicative mismatch errors to accumulate. In
any of these cases, mismatch repair may exhibit a preference for removing particular mismatches.
We analyzed the frequency and pattern of mutation in V
genes from mice deficient for the MSH2 protein because
this protein is a critical component of repair complexes that
initially bind DNA mismatches. MSH2-deficient mice
demonstrate a lack of mismatch repair in that they have unstable microsatellite repetitive sequences in transformed
cells, and they have a high incidence of lymphoid tumors
(7). MSH2-deficient cells from mice or humans are also defective in repairing single-base mismatches (10) and have elevated mutation rates (11). Overall, the immune system of Msh2
/
mice appears to be relatively normal in
that the composition of T and B cells is similar to Msh2+/+
mice (8). Thus, these mice should respond to antigen, and it will be possible to see what the pattern of hypermutation
looks like before MSH2-dependent repair processes the
mutations.
 |
Materials and Methods |
Mice.
MSH2-deficient mice were generated by an insertion
of a neomycin-resistance (neo) gene into one of the exons encoding MSH2 (8). Mice heterozygous for the Msh2 gene on a mixed
C57BL/6 and 129/Ola background were mated to produce F1
progeny. The mice were genotyped using a PCR-specific assay
on DNA from ear notches. Two 8-wk-old Msh2
/
mice were
immunized intraperitoneally with 100 µg of phenyl-oxazolone coupled to chicken serum albumin (provided by M. Neuberger,
Cambridge, UK) in adjuvant (RIBI ImmunoChem Research,
Inc., Hamilton, MT). 4 wk later, the mice were given a secondary injection of 40 µg of antigen in adjuvant. 4 d later, the mice
were killed and the spleens removed. Some 5% of splenic B cells
that bound the B220 surface marker and peanut agglutinin (PNA)
were sorted by flow cytometry using a FACStar Plus® (Becton
Dickinson, San Jose, CA). Approximately 100 ng of DNA was
isolated from about 50,000 cells after proteinase K digestion and
phenol/chloroform extraction.
Detection of Neo Insert.
To confirm that the mice used in this
study contained the neo insert on both alleles, splenic DNA from
the same B220+PNA+ B cells that were analyzed for mutation
was amplified by PCR using primer sequences obtained from
Tak Mak (Amgen Institute, Toronto, Canada). To detect the
wild-type exon, primers specific for the 5' intron and Msh2 exon
were used, which would generate a 174-bp fragment: 5' primer
U771, 5'GCTCACTTAGACGCCATTGT3', and 3' primer
L926, 5'AAAGTGCACGTCATTTGGA3'. To detect the neo
insert, primers specific for the 5' intron and the neo gene were
used, which would generate a 460-bp product: 5' primer U771 as
above, and 3' primer L1211, 5'GCCTTCTTGACGAGTTCTTC3'. A heterozygous mouse would produce both fragments. 10 ng of DNA from B220+PNA+ spleen cells from
C57BL/6 mice or Msh2
/
mice was amplified for 40 cycles and
the products were detected by gel electrophoresis. As shown in
Fig. 1, C57Bl/6 DNA contained the wild-type Msh2 gene, and
the Msh2
/
DNA had the correct size for a neo insertion into the
Msh2 gene.

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 1.
Detection of a neo insert in the Msh2 gene in B220+PNA+
splenic B cells from Msh2 / mice. PCR products were electrophoresed
through an agarose gel and stained with ethidium bromide. Lane 1, 100-bp ladder; lanes 2-5, amplification of DNA with primers as noted.
|
|
V Gene Cloning and Sequencing.
The rearranged V gene for
the
light chain that binds to oxazolone (V
Ox1) gene was amplified from 20 ng of DNA by 30 rounds of PCR with Pyrococcus
furiosus (Pfu) polymerase (Stratagene, La Jolla, CA) using a primer
specific for the leader sequence on the 5' side of the gene and a
primer specific for the J
5 gene segment on the 3' side. 1/25 of
the reaction was then amplified for another 30 rounds using
nested primers containing restriction sites. The 487-bp product,
which included 5' intron and V-J exon sequences, was cloned
into M13 bacteriophage, and DNA from plaques was sequenced.
The error-rate for Pfu polymerase under these conditions is 8 × 10
7 mutations/bp/duplication (14; Gearhart, P.J., data not
shown); after 60 rounds of amplification of a 487-bp fragment,
the cumulative error rate is 200-fold less than the number of mutations detected in the V
Ox1 gene.
Statistical Analysis.
A statistical test of whether the mutation
frequency in A·T pairs is equal to the mutation frequency in G·C
pairs was based on the ratio of the number of mutations in A·T
pairs to the number of mutations in G·C pairs. The level of significance was determined using exact Poisson calculations (15),
with correction for the unequal base composition in the region
studied, where there are 263 A·T pairs and 203 G·C pairs.
 |
Results |
MSH2-Deficient Mice Have Hypermutated Antibodies.
We
studied mutation in the rearranged V
Ox1 gene segment
because immunization of mice with oxazolone elicits a
well-characterized antibody response (16). Some 38 clones
were sequenced over a length of 487 bp, which included
190 nucleotides of 5' intron sequence between the leader
and V gene segment, and 297 nucleotides of the V-J gene.
Sequences at the V-J junction were used to establish clonal
identity, but were not included in the mutational analysis because variant nucleotides at the site of joining may be introduced by the recombination mechanism rather than by
the hypermutation pathway. Thus, mutations were recorded for 466 nucleotides starting downstream of the
leader sequence in the 5' intron and ending in the V gene
before the J gene segment. 44 out of 60 Msh2
/
clones
had mutation, or 73%, compared to 49 out of 82 Msh2+/+
clones with mutation, or 60%. To calculate the frequency
of mutation, we only considered the mutated clones. This
ensures that the analysis is performed on clones from B cells
that have been activated to mutate, rather than including
nonmutated clones from B cells that may not have been
stimulated. 22 of the mutated Msh2
/
clones were unique
in that they either had different sequences at the V-J junction, indicating they came from independent precursor B
cells, or they had unique single substitutions that were not shared by other clones. As listed in Table 1, the number of
mutations per Msh2
/
clone ranged from 1 to 14, with an
average frequency of 1.3% mutations/bp. This frequency is
very similar to that found in Msh2+/+ C57BL/6 clones for
the V
Ox1 gene, where the number of mutations per clone
ranged from 1 to 17, with an average frequency of 1.4%
mutations/bp (18). All 135 mutations in Table 1 were nucleotide substitutions, and only three were located in the 5' intron. Three pairs of tandem mutations, or two substitutions in a row, were observed.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 2.
Location of mutations in the V Ox1 gene from
Msh2+/+ C57BL/6 and Msh2 /
mice. The coding region of the
V Ox1 gene segment is shown;
nucleotide and codon numbering is according to Kabat et al.
(19). The 276-bp coding region
contained 90% of all mutations
occurring in the entire 466-bp
sequence. Msh2+/+ C57BL/6
substitutions (18) are displayed
above the coding sequence and
Msh2 / substitutions are
shown below. Codons 34 (nt
97-99) and 36 (nt 103-105) are
underlined.
|
|
To determine if the pattern of mutation differs between
Msh2
/
clones and Msh2+/+ C57BL/6 clones, the position and types of mutations were identified. As shown in
Fig. 2, many of the mutations in both strains of mice were
located in the first complementarity-determining region at amino acid codons 34 and 36 (nucleotides [nt] 97-99 and
103-105). Mutations at these residues have been shown to
increase the affinity of antibodies by 10-fold (20) because
these sites directly interact with the oxazolone molecule
(21). Thus, B cells expressing antibodies with mutations in
codons 34 and 36 are highly selected based on their greater
affinity for antigen than nonmutated antibodies. Comparing the patterns, several hypermutable sites were observed in Msh2
/
clones but not in Msh2+/+,C57BL/6 clones: nt
96 (codon 33), which is not located in the RGYW motif
that is suggested to be a preferential sequence for mutation
(22), and nt 227 (codon 77), which is in an RGYW sequence.
Msh2
/
Clones Have Predominantly Mutations at G and C
Nucleotides.
The data in Fig. 2 demonstrate that most of
the mutations in the Msh2
/
clones are substitutions for
germline G or C. An analysis of the nucleotide changes for
each base is summarized in Table 2. For comparison, data
from identical mutational analyses of V
Ox1 genes (18)
from another mismatch repair-deficient strain, Pms2
/
, a
nucleotide excision repair-deficient strain, xeroderma pigmentosum group A (Xpa
/
), and the C57BL/6 strain are
also included. In the Msh2
/
sequences, very few mutations at germline A and T and a much greater proportion
of mutations at germline G and C were observed in comparison to the other three strains. Msh2
/
clones exhibited
only nine mutations at A and T versus 91 mutations at G
and C, whereas clones derived from the other strains had approximately the same number of mutations at A·T and
G·C pairs. When corrected for nucleotide composition, a
ratio of 1.3:1 mutations at A·T to G·C pairs would be expected if the mutation rates at both pairs were equal. As
shown in Fig. 3, P values for whether the ratio was 1.3:1
were <10
6 for Msh2
/
clones, 0.21 for Pms2
/
clones,
0.20 for Xpa
/
clones, and 0.90 for C57BL/6 clones.
Thus, hypermutation of the V
Ox1 gene in Msh2
/
mice
is vastly skewed towards targeting G·C pairs compared to the other strains.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 3.
Bias for mutations at G·C pairs in Msh2 / clones. Frequencies of mutation of germline nucleotide pairs to any other base were calculated after correction for base composition. P values for whether the mutation frequency in A·T pairs is equal to the mutation frequency in G·C
pairs are shown.
|
|
 |
Discussion |
Msh2
/
mice do not appear to be immunodeficient for
hypermutation by the following criteria. First, these mice
possess the same percentage of PNA+ B cells as Msh2+/+
mice, suggesting that the B cells passaged through germinal
centers (23). Second, the frequency of mutation between
Msh2
/
and Msh2+/+ C57BL/6 clones was identical, indicating that there was active hypermutation at the V
Ox1
locus. Third, B cells in both strains of mice underwent affinity maturation as codons 34 and 36 were selected for the
mutations that produce high affinity antibodies to oxazolone (20, 21). It is quite possible that Msh2
/
mice
have other immune defects; for example, they may have
fewer germinal centers. However, it has been shown that
hypermutation and affinity maturation can proceed in the
absence of germinal centers (24).
Unexpectedly, the frequency of mutation was not higher
in V
genes from MSH2-deficient mice compared to wild-type mice. Jacobs et al. (25) also reported a normal frequency of mutation in the V
1 gene from Msh2
/
mice.
Perhaps the hypermutation frequency in V genes is already so high at 10
2 mutations/bp that the molecule cannot tolerate higher loads of mutation because the antibody protein
will be nonfunctional. Since MSH2 is necessary for canonical mismatch repair, the data strongly suggest that this repair pathway is not required to generate somatic hypermutation in V genes. We observed a high level of mutation (0.9% mutations/bp) in the V
Ox1 gene from mice deficient for another mismatch repair protein, PMS2 (18), further confirming that mismatch repair does not generate
mutations in immunoglobulin genes. On the other hand,
Cascalho et al. (26) reported a decreased frequency of mutation in Pms2
/
quasimonoclonal mice and suggested that
mismatch repair is involved in fixing mutation once it is
generated. Since many factors can influence the frequency
of mutation, such as quality of antigen stimulation, rate of
transcription (27), and germinal center formation (24), decreased frequencies should be interpreted with caution.
Furthermore, localized inactivation of the mismatch repair pathway is not solely responsible for permitting large
numbers of mutations to remain around the rearranged V
gene. Indeed, an active mechanism for increasing the base
substitution frequency must be used to generate the observed frequency of 10
2 mutations/bp. Simple inactivation of mismatch repair may reveal frequent insertions and
deletions of nucleotides that are produced by slippage of
DNA polymerase during normal semiconservative DNA replication (8, 28). Insertions and deletions would be most evident in the noncoding flanking sequences where they
would not cause a frameshift. In this study, there were no
insertions or deletions in the 5' flanking or coding regions
of V genes from Msh2
/
mice. However, occasional insertions and deletions that are templated by adjacent nucleotides have been identified in a recent study (29), which
suggests that slippage of DNA polymerase occurs infrequently.
Tandem mutations of two in a row were observed at a
high frequency in another mismatch repair-deficient strain
lacking PMS2 (18), suggesting that the PMS2 component
of the mismatch repair pathway is involved in repairing
doublet mutations. To determine if the MSH2 protein is
also used to repair tandem mutations, we analyzed the mutational pattern. Three tandem mutations in Msh2
/
clones were observed (Table 1) compared to 1.8 expected
by chance, and exact Poisson calculations indicate no significant excess of tandem mutations (P = 0.56). In contrast,
there were 11 tandem mutations observed in Pms2
/
clones compared to only 1.2 expected (P < 10
6). Thus,
repair of tandem mutations introduced by the hypermutation mechanism is dependent on PMS2, but appears largely
independent of MSH2, suggesting a pathway for repair of
certain mismatches that does not involve all the canonical
components of mismatch repair.
MSH2 appears to play a dominant role in modifying the
spectrum of mutations formed during hypermutation. A
very different mutational pattern was seen in the Msh2
/
clones, with the vast majority of mutations occurring at
germline G and C nucleotides compared to A and T nucleotides (P < 10
6). We noticed that data from Jacobs et al.
(25) had a similar bias for mutation at G·C pairs in rearranged V
genes from an independently derived MSH2-deficient mouse (7). Our calculations of P values for their
data showed that Msh2
/
clones had a significant excess of
mutations at G·C pairs (P = 0.001) unlike clones from
wild-type and other DNA repair-deficient mice in their
study (P > 0.4). Although the effect of driving mutation at
G·C pairs produced new hot spots of mutation with corresponding amino acid changes in the V
Ox1 gene (Fig. 2),
the G·C bias did not affect selection for high affinity antibodies. Thus, infrequent mutations of A at nt 104 in codon
36 were strongly selected because they change the tyrosine
codon to phenylalanine, which confers a 10-fold increase
in affinity on the antibody molecule (20, 21).
The skewed mutational pattern in Msh2
/
clones predicts that during hypermutation, either G or C are chemically modified to cause mispairing, or an error-prone polymerase frequently introduces a wrong base opposite these
nucleotides. For convention, all the mutations in Table 2
were recorded from the coding strand, although it is not
known on which strand mutations actually occur. Chemical modifications of G and C can occur by several methods.
First, G can be oxidized to 8-oxyguanine (30) that, if not
removed by the base excision repair pathway, preferentially
pairs with A to cause a G to T transversion on one strand
or the corresponding C to A transversion on the opposite
strand. Germinal centers express a high level of 8-oxoguanine glycosylase (31), suggesting there is a high level of oxygen radicals in this tissue. However, this cannot be a major mechanism of somatic hypermutation in V genes since
G to T and C to A changes only account for 1-5% of the
substitutions in all four strains of mice shown in Table 2.
Second, 5-methyl C in a CpG motif can undergo deamination to produce the C to T transition (32). However, none
of the mutations occurred at CpG dinucleotides. Third, C
could spontaneously deaminate to produce uracil, leading to
a C to T transition (33), or C could be oxidized to 5-hydroxy
cytidine (34), but these damaged bases are usually removed
by uracil-DNA glycosylase and endonuclease III type enzymes. It is possible that some of these enzymes are deficient in germinal centers from Msh2
/
mice, which could
produce the altered pattern. Alternatively, an error-prone
polymerase could frequently introduce a wrong base opposite G or C. One of the known DNA polymerases may be
modified to become more error prone (for review see reference 35), or a novel polymerase may be expressed in germinal centers to generate the high frequency of substitutions.
Concomitantly, the data predict that MSH2 preferentially corrects mismatches of G or C relative to mismatches
of A or T. For example, if a DNA polymerase puts T opposite a germline G, the G·T mismatch will be recognized
by a heterodimer of MSH2 and MSH6 proteins (36, 37). In
the absence of MSH2, G·T mispairs would remain and
produce an increased frequency of G to A mutations. In
the presence of MSH2, the disproportionate number of
mismatches at G or C would be corrected, and the final
frequency of mutation at germline-encoded G·C and A·T
pairs would be equal. MSH2-dependent repair of G and C
mismatches in V genes appears to be independent of
PMS2, since a G·C bias was not observed in Pms2
/
clones. As MSH2 normally forms a heterodimer with the
MSH6 or MSH3 proteins during conventional mismatch
repair (38), it will be interesting to determine the phenotype of mutation in mice deficient for the latter two proteins.
A bias for mutations at G·C pairs has been reported in
IgM molecules from Xenopus and horned shark (39),
raising the possibility that this phenotype indicates low or
absent levels of the MSH2 protein in some cold blooded
vertebrates. Mismatch repair has not been studied in these
species, and it would be interesting to see if they are deficient in repair of G and C mismatches. A bias for mutations
at G and C bases was also noted in a murine pre-B cell line
(42). Similarly, humans with defective Msh2 genes, as identified by susceptibilty to colorectal and other cancers (43),
may have altered patterns of hypermutation that affect the
ability of their antibodies to bind antigen efficiently.
Address correspondence to Dr. P.J. Gearhart, Laboratory of Molecular Genetics, National Institute of Aging,
Gerontology Research Center, National Institutes of Health, 5600 Nathan Shock Dr., Baltimore, MD
21224. Phone: 410-558-8561; Fax: 410-558-8157; E-mail: gearharp{at}grc.nia.nih.gov
Received for publication 6 March 1998 and in revised form 7 April 1998.
We gratefully thank Francis Chrest for assistance in flow cytometry, Michael Neuberger for antigen, Andrew
Wakeham for adviceThis work was supported in part by National Institutes of Health grants CA-56542 and CA-67007 (R. Fishel).
| 1.
|
Wagner, S.D., and
M.S. Neuberger.
1996.
Somatic hypermutation of immunoglobulin genes.
Annu. Rev. Immunol.
14:
441-457
[Medline].
|
| 2.
|
Smith, D.S.,
G. Creadon,
P.K. Jena,
J.P. Portanova,
B.L. Kotzin, and
L.J. Wysocki.
1996.
Di- and trinucleotide target
preferences of somatic mutagenesis in normal and autoreactive B cells.
J. Immunol.
156:
2642-2652
[Abstract].
|
| 3.
|
Modrich, P., and
R. Lahue.
1996.
Mismatch repair in replication fidelity, genetic recombination, and cancer biology.
Annu. Rev. Biochem.
65:
101-133
[Medline].
|
| 4.
|
Golding, G.B.,
P.J. Gearhart, and
B.W. Glickman.
1987.
Patterns of somatic mutations in immunoglobulin variable genes.
Genetics.
115:
169-176
[Abstract/Free Full Text].
|
| 5.
|
Brenner, S., and
C. Milstein.
1966.
Origin of antibody variation.
Nature.
211:
242-243
[Medline].
|
| 6.
|
Gearhart, P.J., and
D.F. Bogenhagen.
1983.
Clusters of point
mutations are found exclusively around rearranged antibody
variable genes.
Proc. Natl. Acad. Sci. USA.
80:
3439-3443
[Abstract/Free Full Text].
|
| 7.
|
de Wind, N.,
M. Dekker,
A. Berns,
M. Radman, and
H. te
Riele.
1995.
Inactivation of the mouse Msh2 gene results in
mismatch repair deficiency, methylation tolerance, hyperrecombination, and predisposition to cancer.
Cell.
82:
321-330
[Medline].
|
| 8.
|
Reitmair, A.H.,
R. Schmits,
A. Ewel,
B. Bapat,
M. Redston,
A. Mitri,
P. Waterhouse,
H.-W Mittrucker,
A. Wakeham, and
B. Liu.
1995.
MSH2 deficient mice are viable and susceptible to
lymphoid tumours.
Nat. Genet.
11:
64-70
[Medline].
|
| 9.
|
Cranston, A.,
T. Bocker,
A. Reitmair,
J. Palazzo,
T. Wilson,
T. Mak, and
R. Fishel.
1997.
Female embryonic lethality in
mice nullizygous for both Msh2 and p53.
Nat. Genet.
17:
114-118
[Medline].
|
| 10.
|
Umar, A.,
J.C. Boyer,
D.C. Thomas,
D.C. Nguyen,
J.I. Risinger,
J. Boyd,
Y. Ionov,
M. Perucho, and
T.A. Kunkel.
1994.
Defective mismatch repair in extracts of colorectal and
endometrial cancer cell lines exhibiting microsatellite instability.
J. Biol. Chem.
269:
14367-14370
[Abstract/Free Full Text].
|
| 11.
|
Malkhosyan, S.,
A. McCarty,
H. Sawai, and
M. Perucho.
1996.
Differences in the spectrum of spontaneous mutations
in the hprt gene between tumor cells of the microsatellite mutator phenotype.
Mutat. Res.
316:
249-259
[Medline].
|
| 12.
|
Reitmair, A.H.,
R. Risley,
R.G. Bristow,
T. Wilson,
A. Ganesh,
A. Jang,
J. Peacock,
S. Benchimol,
R.P. Hill,
T.W. Mak, et al
.
1997.
Mutator phenotype in Msh2-deficient murine embryonic fibroblasts.
Cancer Res.
57:
3765-3771
[Abstract/Free Full Text].
|
| 13.
|
Andrew, S.E.,
M. McKinnon,
B.S. Cheng,
A. Francis,
J. Penney,
A.H. Reitmair,
T.W. Mak, and
F.R. Jirik.
1998.
Tissues of MSH2-deficient mice demonstrate hypermutability on exposure to a DNA methylating agent.
Proc. Natl.
Acad. Sci. USA.
95:
1126-1130
[Abstract/Free Full Text].
|
| 14.
|
Zheng, B.,
W. Xue, and
G. Kelsoe.
1994.
Locus-specific somatic hypermutation in germinal centre T cells.
Nature.
372:
556-559
[Medline].
|
| 15.
| Brownlee, K.A. 1965. Statistical Theory and Methodology in
Science and Engineering. Wiley Press, New York. 183.
|
| 16.
|
Kaartinen, M.,
G.M. Griffiths,
A.F. Markham, and
C. Milstein.
1983.
mRNA sequences define an unusually restricted
IgG response to 2-phenyloxazolone and its early diversification.
Nature.
304:
320-324
[Medline].
|
| 17.
|
Rada, C.,
A. Gonzalez-Fernandez,
J.M. Jarvis, and
C. Milstein.
1994.
The 5' boundary of somatic hypermutation in a
V gene is in the leader intron.
Eur. J. Immunol.
24:
1453-1457
[Medline].
|
| 18.
| Winter, D.B., Q.H. Phung, A. Umar, S.M. Baker, R.E.
Tarone, K. Tanaka, R.M. Liskay, T.A. Kunkel, V.A. Bohr,
and P.J. Gearhart. 1998. Altered spectra of hypermutation in
antibodies from mice deficient for the DNA mismatch repair
protein PMS2. Proc. Natl. Acad. Sci. USA. In press.
|
| 19.
| Kabat, E.A., T.T. Wu, H.M. Perry, K.S. Gottesman, and C. Foeller. 1991. Sequences of Proteins of Immunological Interest. 5th ed. U.S. Department of Health and Human Services,
Bethesda, MD. 1300 pp.
|
| 20.
|
Griffiths, G.M.,
C. Berek,
M. Kaartinen, and
C. Milstein.
1984.
Somatic mutation and the maturation of immune response to 2-phenyl oxazolone.
Nature.
312:
271-275
[Medline].
|
| 21.
|
Alzari, P.M.,
S. Spinelli,
R.A. Mariuzza,
G. Boulot,
R.J. Poljak,
J.M. Jarvis, and
C. Milstein.
1990.
Three-dimensional
structure determination of an anti-2-phenyloxazolone antibody: the role of somatic mutation and heavy/light chain
pairing in the maturation of an immune response.
EMBO
(Eur. Mol. Biol. Organ.) J.
9:
3807-3814
[Medline].
|
| 22.
|
Rogozin, I.B., and
N.A. Kolchanov.
1992.
Somatic hypermutagenesis in immunoglobulin genes. II. Influence of
neighboring base sequences on mutagenesis.
Biochim. Biophys.
Acta.
1171:
11-18
[Medline].
|
| 23.
|
Coico, R.F.,
B.S. Bhogal, and
G.J. Thorbecke.
1983.
Relationship of germinal centers in lymphoid tissue to immunologic memory. VI. Transfer of B cell memory with lymph
node cells fractionated according to their receptors for peanut
agglutinin.
J. Immunol.
131:
2254-2257
[Abstract].
|
| 24.
|
Matsumoto, M.,
S.F. Lo,
C.J.L. Carruthers,
J. Min,
S. Mariathasan,
G. Huan,
D.R. Plas,
S.M. Martin,
R.S. Geha,
M.H. Nahm, and
D.D. Chaplin.
1996.
Affinity maturation without
germinal centres in lymphotoxin- -deficient mice.
Nature.
382:
462-466
[Medline].
|
| 25.
|
Jacobs, H.,
Y. Fukita,
G.T.J. van der Horst,
J. de Boer,
G. Weeda,
J. Essers,
N. de Wind,
B.P. Engelward,
L. Samson,
S. Verbeek, et al
.
1998.
Hypermutation of immunoglobulin
genes in memory B cells of DNA repair-deficient mice.
J.
Exp. Med.
187:
1735-1743
[Abstract/Free Full Text].
|
| 26.
|
Cascalho, M.,
J. Wong,
C. Steinberg, and
M. Wabl.
1998.
Mismatch repair co-opted by hypermutation.
Science.
279:
1207-1210
[Abstract/Free Full Text].
|
| 27.
|
Goyenechea, B.,
N. Klix,
J. Yelamos,
G.T. Williams,
A. Riddell,
M.S. Neuberger, and
C. Milstein.
1997.
Cells
strongly expressing Igk transgenes show clonal recruitment of
hypermutation: a role for both MAR and the enhancers.
EMBO (Eur. Mol. Biol. Organ.) J.
16:
3987-3994
[Medline].
|
| 28.
|
Aaltonen, L.A.,
P. Peltomaki,
F.S. Leach,
P. Sistonen,
L. Pylkkanen,
J.-P. Mecklin,
H. Jarvinen,
S.M. Powell,
J. Jen, and
S.R. Hamilton.
1993.
Clues to the pathogenesis of familial
colorectal cancer.
Science.
260:
812-816
[Abstract/Free Full Text].
|
| 29.
|
Wilson, P.C.,
O. De Bouteiller,
Y.-J. Liu,
K. Potter,
J. Banchereau,
J.D. Capra, and
V. Pascual.
1998.
Somatic hypermutation introduces insertions and deletions into immunoglobulin V genes.
J. Exp. Med.
187:
59-70
[Abstract/Free Full Text].
|
| 30.
|
Kasai, H., and
S. Nishimura.
1984.
Hydroxylation of deoxyguanosine at the C-8 position by ascorbic acid and other reducing agents.
Nucleic Acids Res.
12:
2137-2145
[Abstract/Free Full Text].
|
| 31.
|
Kuo, F.C., and
J. Sklar.
1997.
Augmented expression of a human gene for 8-oxoguanine DNA glycosylase (MutM) in B
lymphocytes of the dark zone in lymph node germinal centers.
J. Exp. Med.
186:
1547-1556
[Abstract/Free Full Text].
|
| 32.
|
Coulondre, C.,
J.H. Miller,
P.J. Farabaugh, and
W. Gilbert.
1978.
Molecular basis of base substitution hotspots in Escherichia coli.
Nature.
274:
775-780
[Medline].
|
| 33.
|
Lindahl, T..
1993.
Instability and decay of the primary structure of DNA.
Nature.
362:
709-715
[Medline].
|
| 34.
|
Wang, D., and
J.M. Essigmann.
1997.
Kinetics of oxidized
cytosine repair by endonuclease III of Escherichia coli.
Biochemistry.
36:
8628-8633
[Medline].
|
| 35.
|
Kunkel, T.A..
1992.
DNA replication fidelity.
J. Biol. Chem.
267:
18251-18254
[Free Full Text].
|
| 36.
|
Drummond, J.T.,
G.-M. Li,
M.J. Longley, and
P. Modrich.
1995.
Isolation of an hMSH2- p160 heterodimer that restores
DNA mismatch repair to tumor cells.
Science.
268:
1909-1912
[Abstract/Free Full Text].
|
| 37.
|
Palombo, F.,
P. Gallinari,
I. Iaccarino,
T. Lettieri,
M. Hughes,
A. D'Arrigo,
O. Truong,
J.J. Hsuan, and
J. Jiricny.
1995.
GTBP, a 160-kilodalton protein essential for mismatch-binding activity in human cells.
Science.
268:
1912-1914
[Abstract/Free Full Text].
|
| 38.
|
Acharya, S.,
T. Wilson,
S. Gradia,
M.F. Kane,
S. Guerrette,
G.T. Marsischky,
R. Kolodner, and
R. Fishel.
1996.
hMSH2
forms specific mispair-binding complexes with hMSH3 and
hMSH6.
Proc. Natl. Acad. Sci. USA.
93:
13629-13634
[Abstract/Free Full Text].
|
| 39.
|
Wilson, M.,
E. Hsu,
A. Marcuz,
M. Courtet,
L. du Pasquier, and
C. Steinberg.
1992.
What limits affinity maturation of
antibodies in Xenopus-the rate of somatic mutation or the
ability to select mutants?
EMBO (Eur. Mol. Biol. Organ.) J.
11:
4337-4347
[Medline].
|
| 40.
|
Hinds-Frey, K.R.,
H. Nishikata,
R.T. Litman, and
G.W. Litman.
1993.
Somatic variation precedes extensive diversification of germline sequences and combinatorial joining in the
evolution of immunoglobulin heavy chain diversity.
J. Exp.
Med.
178:
815-824
[Abstract/Free Full Text].
|
| 41.
|
du Pasquier, L.,
M. Wilson,
A.S. Greenberg, and
M.F. Flajnik.
1998.
Somatic mutation in ectothermic vertebrates:
musings on selection and origins.
Curr. Topics Microbiol. Immunol.
229:
199-216
[Medline].
|
| 42.
|
Bachl, J., and
M. Wabl.
1996.
An immunoglobulin mutator
that targets G·C base pairs.
Proc. Natl. Acad. Sci. USA.
93:
851-855
[Abstract/Free Full Text].
|
| 43.
|
Parsons, R.,
G.-M. Li,
M. Longley,
P. Modrich,
B. Liu,
T. Berk,
S. R. Hamilton,
K.W. Kinzler, and
B. Vogelstein.
1995.
Mismatch repair deficiency in phenotypically normal
human cells.
Science.
268:
738-740
[Abstract/Free Full Text].
|