J. Exp. Med.
Volume 186, Number 6, September 15, 1997 845-858

Enhancer Complexes Located Downstream of Both Human Immunoglobulin C Genes

By Frederick C. Mills, Nagaradona Harindranath, Mary Mitchell, and Edward E. Max

From the Laboratory of Cell and Viral Regulation, Division of Hematologic Products, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, Maryland 20892

Summary

Materials and Methods

Results

Discussion

Footnotes

Acknowledgements

References

Summary

The regulation of human immunoglobulin heavy chain gene expression is incompletely understood, despite clinically significant conditions in which specific isotypes are inappropriately up- or downregulated, e.g., allergies due to inappropriate IgE response, and various forms of immunodeficiency associated with low IgA expression. Clearly, cytokines and interactions between B and T cells play a role in regulating isotype switching, and cis elements in the IgH gene locus which mediate these effects have been documented in the murine and human promoters of the sterile transcripts associated with each heavy chain constant region gene (1, 2). However, in the mouse an additional control region which contributes to regulation of isotype switching has been reported to lie downstream from C, and the corresponding region of the human heavy chain locus has not yet been investigated.

The existence of a regulatory region downstream from murine C was originally inferred when it was found that plasmacytomas which had undergone spontaneous deletions of the only heavy chain enhancer then known, which lies in the intron between JH and Cµ, nevertheless remained capable of high level immunoglobulin secretion (3). Conversely, a myeloma subclone which retained the intronic enhancer but lost a segment of DNA downstream from the murine C gene was found to have markedly reduced its heavy chain gene expression (7). A systematic search in the homologous region of the rat heavy chain locus revealed an enhancer (8), and a homologous mouse enhancer designated 3E was found soon after (9, 10) positioned ~16 kb downstream from C. The mouse and rat 3E segments lie in opposite orientations and are flanked by inverted repeats (9). In addition to the 3E, Matthias and Baltimore also reported a weak enhancer in mouse lying only 4 kb downstream from C (Fig. 1 and reference 11).

More recently, Madisen and Groudine (12) analyzed B cell-specific DNase I hypersensitivity downstream from C and identified four hypersensitive sites. HS1 and HS2 fall in the previously described 3E, whereas HS3 and HS4 lie further downstream and identify two new regions with somewhat weaker enhancer activity in transient transfection assays. The HS3 sequence is almost identical to that of the enhancer described by Matthias and Baltimore but has an inverted orientation. This reflects the fact that the sequence surrounding the HS12-3E is present in the mouse in a long inverted repeat which includes HS3 sequences at both ends (Fig. 1 and reference 13). When constructs containing HS3, HS12, and HS4 linked to a reporter gene were transfected into a B cell line, subsequently isolated stable transfectants were found to express the reporter gene in a position-independent manner. This suggested that the three enhancer sequences (HS12, HS3, and HS4) acted together as a locus control region (LCR)¹. LCRs, first defined in the globin locus (14), activate large domains of chromatin in vivo (100 kb in the human  globin locus), and, as components of DNA constructs in transgenic mice, support gene expression proportional to the number of integrated copies. In contrast, integrated gene constructs lacking LCR sequences are variably expressed, depending on the positions of integration. LCRs typically contain several DNase I hypersensitive sites, which often represent DNA with enhancer activity. In addition to the LCRs found in the  globin and mouse IgH loci, LCRs have also been described as associated with macrophage-specific lysozyme, CD2, and / TCR loci (15).

Analyses of the regulatory regions downstream from murine C have identified several motifs which bind specific transcription factors to mediate different aspects of regulation of enhancer function. The 3E has been found to activate transcription strongly in plasmacytomas, but only weakly in earlier B lymphoid cells. Part of this developmental change is attributable to a motif known as E5, which matches the "E-box" consensus binding site (CANNTG) characteristic for members of the basic helix-loop-helix family of transcription factors. The contribution of the E5 site to enhancer activity is inhibited in early stages of development by the dominant negative nuclear regulator Id3, which is expressed in early B lineage cells but downregulated in plasma cells (16). At least four other motifs in the 3E have been reported to contribute to enhancer activity specifically in plasmacytomas, motifs whose contribution in B cells is inhibited by BSAP (the B cell-specific activator protein), which disappears as B cells mature to plasma cells. These sites include P (17), the octamer motif (ATGCAAAT; reference 18), a B-like site (16), and a G-rich sequence (19). In B cells, BSAP prevents the binding of the transcriptional activator NF-P to the P site, and causes the octamer, G-rich, and B-like motifs to exert an active repressive influence on transcription (17, 19).

Apart from the motifs mediating upregulation of the 3E during maturation to plasma cells, a response element in the enhancer for activation induced by B cell receptor cross-linking has been traced to partially overlapping sites for the ETS family member Elf-1 and for members of the AP-1 transcription factor family (22). Two other motifs in the enhancer have been proposed to contribute to its regulation, but are less well documented: the µE1 and the µB motifs, which were first noted in the rat 3E and which are partially conserved in mouse. The HS3 and HS4 enhancer regions of mouse have been studied in less detail, but the HS4 enhancer apparently contains functional Oct-1 and BSAP binding sites (23).

A role for the 3E in isotype switching was revealed by experiments in which this region was replaced by a neomycin resistance gene through homologous recombination in embryonic stem cells which were then used to reconstitute the B cell population in RAG-2 knockout mice. The resulting B cells showed normal V(D)J recombination but marked deficiencies in switching to IgG2a, IgG2b, IgG3, and IgE in vitro, whereas expression of IgM and IgG1 was normal (24). This observation suggests that the enhancer exerts isotype-specific effects on switch recombination, possibly through its regulation of germline transcription of the different isotypes before switch recombination.

Because the enhancer regions lying downstream from the mouse C gene have been found to be important for heavy chain gene expression and isotype switching, there has been considerable interest in determining how homologous regions might regulate immunoglobulin gene expression in humans. The human heavy chain locus includes two --- segments (25, 26), apparently the product of a large duplication in the primate lineage (27). Isotypes from the upstream duplication, comprising the 3-1--1 constant region genes, are generally expressed at a much higher level than those of the downstream 2-4--2 duplication. The existence of two C genes in humans suggests the possibility that two 3 enhancer complexes may regulate the locus, one downstream from each C gene; differences in these complexes could contribute to the differential regulation of the two duplications. Moreover, individuals who have a -1- deletion on one chromosome show reduced expression of the downstream 2 and 4 genes on that chromosome, indicating that this deletion may have removed a region which exerts distal control over at least some of the human heavy chain genes (28). Finally, the possibility that there are two 3 enhancer complexes makes the human IgH locus an attractive candidate for study because there could be interactions between two adjacent LCRs, a situation which has not been described in any other system.

Several laboratories have attempted to characterize sequences lying downstream from the two human C genes, but technical difficulties have impeded this work. Gene walking downstream from the C genes has been difficult, apparently because of a segment of 20-bp tandem repeats which lies almost immediately downstream of the most 3 exon of both C genes. These tandem repeats, described independently by three laboratories (29), include the sequence GATC recognized by the isoschizomer restriction enzymes Sau3A and MboI. Since commercial human DNA libraries in  phage have been constructed using genomic DNA fragments generated by partial MboI/Sau3A digestion, the repeated Sau3A sites downstream of the C genes make it unlikely that library clones isolated by hybridization to C probes will contain DNA downstream from the repeats.

As an initial step toward defining the role of global control regions in the activation of the human IgH genes, our laboratory has sought to determine: (a) are enhancer complexes located downstream from the human C genes; and (b) how do any such human enhancers correspond to the regulatory sequences described downstream from the murine C gene? Towards this end we have successfully applied several strategies other than gene walking from C to obtain DNA clones extending downstream from the human C genes, enabling us, by functional analysis and sequencing, to characterize enhancer regions 3 of each C gene homologous to those of the mouse HS12, HS3, and HS4.

Materials and Methods

Cloning of 3 Regions from Human Genomic DNA. To obtain DNA between C1 and the previously reported pseudogene which lacks associated S sequences, we initially sought clones containing the pseudogene, which should hybridize to a C probe but not to an S probe. We screened a commercial library of partial MboI-digested human placental DNA in the FixII phage vector (Stratagene, La Jolla, CA) with a C probe: probe f (Fig. 2), a 7-kb HindIII fragment, was isolated from a pBR322 plasmid clone originally derived from  phage CH·Ig·H·g-11(32) (Health Science Research Resources Bank, Osaka, Japan; e-mail: hsrrb{at}nihs.go.jp). C+ plaques were replated and duplicate plaque-lift filters were hybridized with the C probe and an S probe (1,100-bp KpnI to PstI fragment containing human S2; reference 33). Southern blots of BamHI-digested DNA from eight candidate clones (C+, S) were hybridized with a ³²P-labeled oligonucleotide Pseudogam-1 (see Table 1 for sequences of oligonucleotides) specific for the hinge region at 48°C in hybridization buffer (1 M NaCl, 0.1 M sodium phosphate, pH 7.0, 10% dextran sulfate, 10 mM EDTA, 1% SDS), followed by washing at 48°C in 1× SSC, 10 mM EDTA, 0.1% SDS. This analysis identified three overlapping + clones (-25, -2, and -38) extending over an ~30-kb region containing the gene (Fig. 2).

Table 1. Sequences of Oligonucleotides Used in This Study Oligonucleotide name Sequence Pseudogam-1 AGATGCCCACCATGTCAAGT Reverse sequencing primer AACAGCTATGACCATG elkb2 TAAGCTGTCTGAGAGAAAGGTTGGGGGAGG 5TM-A1 CTGTTCACACGAGTCTGGGCCTGG 3TM-B TCCAAGAGGTTCCTCCACACTTCC SA2.5-A2 ggccggtaccGGATCCCGGTTCCTGATCACTG SA2.1-A2 ggccggtaccCTTCCTGCCAACCTGGGGGCTG SA2.5A ggccacgcgtGGATCCCGGTTCCTGATCACTG SA2.6A ggccacgcgtCCACAGTCACTGCCAGATGCTC SA2.1A ggccacgcgtCTTCCTGCCAACCTGGGGGCTG SA2.2B ggccacgcgtGGCTTTTGCCAGTCCTCCTAC SA11.B CAGTGCCCCAACCCAGGACGCCAGCC SA.8A ggccacgcgtCGCTCGCTGCCCCACTCAGGAGG SA.9B ggccacgcgtCTCCTAGCAGGGTCTCCTCCCTGG  5PR-A GAGGAGAAGTCTGCCGTTACTGCCC  3PR-B GGCACAATCCAGATGCTCAAGGCCC All primer sequences are presented 5 to 3. For certain primers derived from human genomic DNA sequence, additional nucleotides were added at the 5 end to provide restriction sites; these nongenomic nucleotides are written in lowercase letters, with the restriction site underlined. All oligonucleotides were prepared in the Facility for Biotechnology Research (Center for Biologics Evaluation and Research, Bethesda, MD).

DNase I Hypersensitive Site Analysis. Nuclei were prepared and digested with DNase I according to a previously described protocol (36). K562 and HS Sultan cells (both obtained from American Type Culture Collection) were grown to densities of 5-8 × 10⁵ cells/ml. For each experiment, 3-6 × 10⁸ cells were harvested, lysed by addition of NP-40, centrifuged through a 1.7 M sucrose cushion, and resuspended in 5 ml; 450-µl aliquots of suspended nuclei were treated with serially diluted DNase I (Boehringer-Mannheim, Indianapolis, IN) to give final DNase I concentrations of 0-8 µg/ml. Nuclei were digested with DNase I for 3 min at 25°C. For one experiment HS Sultan nuclei were digested with the restriction endonuclease SspI (New England Biolabs, Beverly, MA) for 15 min at 37°C. DNase I (or SspI) digestion was terminated by adding 50 µl 1% SDS, 100 mM EDTA. DNA samples were deproteinized for 5-48 h at 37°C using proteinase K (Boehringer-Mannheim) at a final concentration of 100 µg/ml. DNA was purified by phenol/chloroform extraction and ethanol precipitation, resuspended in 50-100 µl deionized water, and DNA concentrations were measured using a Fluorometer (TKO 100; Hoeffer, San Francisco, CA). 5-µg DNA samples were digested for 5-24 h in 50 µl of appropriate restriction enzyme buffer with BglII, EcoRI, or HindIII (New England Biolabs). To assess the SspI sensitivity of the  globin locus in HS Sultan nuclei, a 1,511-bp human  globin probe was amplified from total human genomic DNA using primers 5PR-A and 3PR-B. Restriction-digested samples, together with ³²P-labeled size markers, were electrophoresed, blotted, and hybridized with the probes indicated in the figure legends. After washing the membranes, radioactive images were obtained with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).

Enhancer Assays. To analyze DNA fragments for enhancer activity, we used the luciferase reporter plasmid pGL3 (Promega Corp., Madison, WI), modified so that the SV40 promoter between BglII and HindIII sites was replaced by a 76-bp V promoter (37) containing an octamer motif and TATA box. This plasmid, named pGL3-V, served as an enhancerless, promoter-only control. Fragments to be assayed for enhancer activity were blunt-ended with Klenow fragments of DNA polymerase and ligated with MluI linkers, or amplified with primers incorporating an MluI (or KpnI) site; the fragments were then cloned into the MluI (or KpnI) site in the polylinker upstream of the promoter in pGL3-V. Plasmid DNAs for transfection were twice purified on a CsCl gradient.

Sequence Analysis. A PCR-based methodology employing P³³-labeled ddNTPs was used for sequencing reactions (ThermoSequenase kit; Amersham Life Science, Arlington Heights, IL). All samples were amplified for 50 cycles (95°C for 30 s; 60°C for 30 s; 72°C for 60 s). Sequencing reactions were electrophoresed on 6% gels, dried, autoradiographed, and read manually. All reported sequences were read on both A and B strands, except for the sequences of the HS12 59-bp repeats, which, despite several attempts employing various strategies, could be read only on one strand.

Results

Cloning DNA Downstream of C1 and C2.

Because attempts to clone the human 3 C regions using strategies based on gene walking from C or cross-species hybridization had failed in other laboratories, we used an alternative strategy based on the fact that a C-like pseudogene () has been described downstream of human C1 (32, 38). We reasoned that we could clone DNA downstream of C1 by walking upstream from . The similarity in the restriction maps reported downstream of the two C genes based on Southern blotting (26) furthermore suggested that these regions would be highly similar to each other. Therefore, probes derived by walking upstream from should also hybridize to clones containing DNA from downstream of C2.

By screening a phage library for clones that hybridized to C but not S, and then screening those clones with a -specific oligonucleotide (see Materials and Methods), we obtained three overlapping clones spanning ~30 kb (Fig. 2). To obtain clones covering the corresponding region from the 2 locus, the library was then rescreened with probes b and e (Fig. 2). Clones deriving from downstream of C2 were selected on the basis of restriction site differences between the 1 and 2 which had been established by analysis of genomic Southern blots and comparisons with our cloned DNA from the 1 duplication. Three clones deriving from the 2 locus and spanning ~30 kb were obtained (Fig. 2).

To estimate the distance between our two phage contigs and the corresponding C genes, we performed genomic Southern blot experiments using a panel of restriction enzymes with known sites in the C loci and in our contigs. For example, co-migrating BglII bands of ~35 kb were found to hybridize to both probe a (from the C membrane exon m) and probe b (Fig. 2); these experiments suggested a gap of ~20 kb between each contig and the corresponding membrane exon of C (data not shown). For the 2 locus, the gap was bridged by a BAC clone (see Materials and Methods). The corresponding regions from the 1 locus have resisted direct cloning and have been obtained by PCR using primers designed from the sequence of the 2 locus, as described in Materials and Methods.

To map potential regulatory sequences downstream of the C genes, we used fragments from the cloned DNA downstream of the C2 gene to search for DNase I hypersensitivity sites; in cells where such enhancers or promoters are active, they generally are hypersensitive to endonucleases, apparently because binding of transcription factors disrupts the nuclease protection afforded by nucleosomes. Intact nuclei from the human myeloma HS Sultan were incubated briefly with various concentrations of DNase I; DNA samples purified from these treated nuclei were then analyzed using several Southern blot strategies in order to localize the positions of DNase I cleavage. The analyses were complicated by the fact that all of the probes we used hybridized to both the 1 and 2 loci, but various restriction map differences between the two loci allowed us to position all the hypersensitivity sites with respect to restriction sites mapped from our clones.

Fig. 3 A demonstrates analyses of DNA from the promyelocyte K562 line, representative of a cell not expressing immunoglobulin genes, and the myeloma HS Sultan line. The DNase I-treated DNA was digested with BglII, which cuts ~1 kb upstream of the membrane exon of both C genes; the blots were hybridized with a probe corresponding to this exon. Since the next downstream BglII site is >20 kb away, this strategy can display hypersensitivity sites over this wide distance from the  membrane exon. The blot demonstrates at least seven hypersensitivity sites, which were subsequently assigned to the 1 or 2 locus by other blotting experiments and were named according to sequence similarity to the homologous murine regions as described below. The sites we have tentatively designated 1X and 2X do not correspond to any reported murine enhancer sequence. None of these sites were visible in the DNA from K562, in which the enhancer region is expected to be inactive.

m

The BglII blot of HS Sultan DNA fails to resolve the two HS4 sites because they are too far away from the BglII sites. The two HS4 sites were resolved by an alternative Southern blot strategy employing EcoRI digests of the DNA from DNase I-digested nuclei (Fig 3 B). To determine which of the two resulting bands represented HS4 from the 1 versus 2 loci, we exploited the observation from our sequence analysis that recognition sites for the restriction enzyme SspI lie in each HS4 site. Since many regulatory regions accessible to DNase I are also accessible to restriction endonucleases, we digested HS Sultan nuclei with SspI and localized the cleavage sites by isolating the DNA, digesting with EcoRI, and hybridizing Southern blots with probe b as shown in Fig. 3 B. From the map positions of the 1 and 2 SspI sites we assigned the SspI hypersensitivity bands as shown in Fig. 3. A control experiment on the same DNA isolated from SspI-digested HS Sultan nuclei demonstrated that SspI recognition sites in the  globin locus were not cut, indicating that the SspI sites associated with HS4 were indeed hypersensitive in HS Sultan cells (data not shown; see Materials and Methods).

Fig. 3 C illustrates an experiment which allowed assignment of several HS sites to the 2 locus rather than 1. DNA samples from DNase I-treated HS Sultan nuclei were digested with HindIII and hybridized with a probe for the HS12 site derived from the 2 locus. Although this probe hybridizes to both the 1 and 2 loci, in this DNA the 1 band is ~23 kb, so large that any fragments from this locus that were generated by HindIII and DNase I and which hybridized to the probe would be larger than the 12-kb band representing the 2 locus. Thus all HS bands <12 kb derive from 2. This blot therefore defines the position of the HS12, X, and HS3 sites in the 2 locus. By implication, the other HS sites in the BglII blot of Fig. 3 A must derive from 1. (It should be noted that a common allele in other DNA samples shows an additional polymorphic HindIII site which cuts within the 23 kb corresponding to the HS Sultan band; this allele would have confounded the above strategy, but was absent in HS Sultan.)

To analyze enhancer activity in the cloned DNA downstream of the C2 locus, fragments containing one or more DNase I hypersensitive sites were subcloned into a luciferase reporter gene driven by a V promoter as described in Materials and Methods. Luciferase activity in each sample was normalized to the -galactosidase activity of the promoter-only control plasmid, and expressed as fold-increase over luciferase activity of that control plasmid.

The luciferase assays (Fig. 4) revealed strong enhancer activity in the 5-kb SmaI-HindIII fragment (SM5) which was found to contain sequence homologous to murine HS12 (see below). Within this fragment, enhancer activity seemed to be confined to the 1.3-kb EcoRI-HindIII fragment (EH1.3) containing the HS12 site. This segment was further cut into an upstream 0.3-kb EcoRI-PstI fragment (EP300), a 0.3-kb PstI-PstI fragment (P300), and a 0.6-kb PstI-HindIII fragment (PH600). Of these, only the P300 fragment, which contained HS12, showed enhancer activity. However, it should be noted that the enhancer activity of P300 was less than that measured for a larger PCR-generated fragment A2HS12. Thus it is possible that additional elements that do not show intrinsic enhancer activity when isolated in constructs can nevertheless augment the activity of the core HS12 enhancer lying in the P300 fragment. Furthermore, the EH1.3 fragment, but not the slightly shorter A2HS12 fragment, showed significantly less enhancer activity in the A orientation, suggesting the possibility of inhibitory sequences located near one of the ends of EH1.3.

Two fragments containing the 2 HS3 site showed no significant enhancer activity in the luciferase construct, but a plasmid in which the HS3-containing 0.7-kb BamHI-SmaI fragment was dimerized showed consistent low activity (Fig. 4, SM0.7-X2). The homologous murine enhancer was reported to show greater activity with a c-myc promoter than with an immunoglobulin V promoter (12), but we found no significant increase in enhancer activity when the V promoter was replaced by a human c-myc promoter (data not shown; construct described in Materials and Methods).

Two restriction fragments, B5.5 and SpB0.9, containing the 2 HS4 site demonstrated significant stimulation of luciferase activity, but only when cloned in the B (inverted) orientation (Fig. 4 A). When these fragments were oriented so that the DNA strand continuous with the transcribed strand in the luciferase gene corresponded to the transcribed strand of the immunoglobulin gene in genomic DNA (the A orientation), luciferase activity was no greater than that from the promoter-only plasmid. Unexpectedly, a smaller fragment (the 468-bp PCR-generated fragment designated A2-HS4, designed to span the sequence showing the strongest homology to the murine HS4 site) was found to give a strong activation of luciferase activity. The stronger activation of luciferase conferred by the short A2-HS4 PCR fragment compared with that of the longer SpB0.9 fragment (in the same A orientation) suggests that the latter may contain an inhibitory sequence that is either position- or orientation-dependent. This possibility is currently being explored.

Because of the lack of genomic clones spanning the HS3, HS12, and HS4 regions of 1 locus, fragments corresponding to each of these sites were obtained by PCR and analyzed; and, to facilitate 1 versus 2 locus comparisons, the same primer pairs were used to generate corresponding fragments from the 2 locus. As shown in Fig. 4, the activity of each HS site fragment from 1 was similar to that from the 2 locus (compare SM0.7-X2 2 versus HS3-X2 1; A2HS12 2 versus A1HS12T 1; and A2-HS4 2 versus A1-HS4 1). The PCR amplification of the HS12 site yielded two fragments, designated A1HS12T (top) and A1HS12B (bottom), which differ in size by <0.1 kb and may represent alleles (see below). Both fragments showed substantial enhancer activity (Fig. 4 B).

Since the mouse 3 enhancers show different activation patterns during B cell differentiation, with HS4 being activated at the pre-B cell stage, while HS12 and HS3 are only active in mature B cells, we examined the activity of the human 3 2 enhancers in a range of human and mouse B cell lines (Table 2). The pattern of activation for the human HS12 enhancer is similar to that of mouse HS12; i.e., human HS12 is inactive in the human pro-B cell line FLEB-14 and the mouse pre-B cell line 18-81, but functions in the human mature B cell line Raji, as well as three plasmacytomas (HS Sultan, human; S194, mouse; and MOPC 315, mouse). HS3 is also inactive in mouse 18-81 pre-B cell line, but shows modest activity in most of the more mature lines tested. HS3 shows surprisingly strong activity in the mouse S194 myeloma, indicating that unknown factors varying between cell lines at similar stages of differentiation can modulate the activity of this enhancer. Finally, the HS4 enhancer shows strong activity in the human pro-B cell line FLEB14, and is also variably active in all of the more mature cell lines (except 18-81) in which this enhancer was assayed in the B orientation.

Table 2. Cell Specifity of Human 2 Enhancer Elements HS12 (EH1.3) HS3 (SM0.7) HS4 (SpB0.9) Cell line A B A B X2 A B Human   FLEB 14 (pro B) 1.9 ± 0.1  1.9 ± 0.1 ND ND ND 2.8 ± 0.2 18.4 ± 2.4   Raji (Mature B) 3.1 ± 2.2  3.2 ± 1.8 0.7 ± 0.2 1.0 ± 0.3  2.8 ± 0.5 1.2 ± 0.1  2.7 ± 0.5   HS Sultan     (Plasmacytoma) 5.3 ± 1.4  22 ± 10 1.54 0.59  2.3 ± 0.5 1.1 ± 0.2  5.4 ± 0.5 Mouse   18-81 (Pre-B) 0.9 ± 0.2  1.1 ± 0.3 1.2 ± 0.1 0.8 ± 0.2  1.6 ± 0.5 0.5 ± 0.1      0.9 ± 0.2   S 194     (Plasmacytoma) 5.3 ± 0.2 14.4 ± 1.0 8.5 ± 0.8 2.6 ± 0.4 16.3 ± 0.3 7.2 ± 1.4 28.4 ± 2.3   MOPC 315     (Plasmacytoma) 5.9 ± 1.1 16.9 ± 1.9 1.4 ± 0.2 0.7 ± 0.2  2.9 ± 1.9 1.3 ± 0.6  5.8 ± 0.9 The numbers given represent the fold-increase of luciferase activity seen with a promoter-only control plasmid, with standard deviation. Numbers in bold were judged to represent significant enhancer activity.

The nucleotide sequence of all DNase I hypersensitivity sites was determined, revealing ~99% sequence identity between the human 1 and 2 elements, and similarity between the human and mouse enhancers ranging from 74 to 90%.

HS12, the strongest enhancer, showed 90% sequence identity to the homologous murine enhancer over a 135-bp core homology (Fig. 5 A). In the 2 locus, four tandem repeats with a 59-bp consensus sequence lie immediately upstream of the HS12 core. However, this sequence has been inverted in Fig. 5 A, to facilitate comparison with the homologous 1 sequence in opposite orientation. In the corresponding region of 1 (which, due to the inversion, lies downstream of the core homology region) a 115-bp deletion removes the second and third repeats; the 1HS12B region shows an additional deletion of 70 bp. The core homology region includes several of the functional motifs identified in the murine enhancer: the AP1-Ets site reported to confer responsiveness to B cell receptor cross-linking (22, 39); an exact octamer sequence (ATGCAAAT); and a µE5 site (except in the 1HS12B sequence, in which the µE5 is missing owing to the 70-bp deletion). The sequences of these three motifs from the human HS12 are identical to their murine homologs except for a single base change in the AP1 site which causes the human sequence to exactly match the consensus AP1 site, where the murine motif has one mismatch. The murine element designated µE1 (39), which has never been thoroughly documented even in the murine enhancer, is poorly conserved in the human homologs. Although the murine binding site for NF-B lies outside the 135-bp region of strongest sequence similarity, a reasonable match to consensus for this element is found in a position roughly homologous to the murine B site in the 1HS12T and 2HS12 sequences, but is part of the 70 bp deleted in 1HS12B. One of the mouse BSAP sites (BSAP2) is not conserved, but most residues in a second mouse BSAP binding site (BSAP1) are maintained in the human 2 HS12 enhancer. The murine P site, which binds to an ETS-related transcription factor which augments enhancer activity (17), is not conserved in the human sequences.

The DNase I hypersensitive sites lying <3 kb downstream from the membrane exons of C1 and C2, roughly in the position of the weak enhancer reported by Matthias and Baltimore (11) and here designated HS3A, were found to contain sequences which are 74% identical to the murine HS3 over a 200 bp core segment. The two human HS3 segments are identical in the 326 bp shown (Fig. 5 B), and lie in the same orientation as HS3A. We have assumed that the correct orientation of the murine HS3A sequence is that described by Chauveau and Cogné (13). This orientation is opposite to that of the murine HS3B, which lies downstream from HS12 in the mouse, as described by Madisen and Groudine (12). Of the enhancer/HS sites downstream of murine C, HS3 is the least well investigated for functional motifs, in part because of its weak enhancer activity. Independent sequence analysis of the murine HS3A and HS3B regions detected several similarities to octamer motifs, AP1 sites, and consensus E box motifs (CANNTG). The AP1 site identified in Fig. 4 is a precise match to the consensus AP1 binding motif TGANTCA (40) in the two human and two mouse HS3 sequences, and the murine sequence has been shown to bind to c-jun and c-fos in vitro (Neurath, M., personal communication). Similarly, several of the E box consensus motifs in the murine sequence have been shown to bind in vitro to proteins of the HLH family (Neurath, M., personal communication); some of these motifs are conserved in the two human HS3 sequences. The significance of the conserved motifs remains uncertain in the absence of a functional analysis of HS3 sequences.

The DNase I hypersensitivity sites furthest downstream from human C1 and C2 in Fig. 3, which we have designated HS4, are 76% similar to the murine HS4 site over a core 145-bp sequence which spans the three functional motifs demonstrated in murine HS4 (23); see Fig. 5 C. The NF-B motif and the downstream octamer motif in Fig. 5 C are both precisely conserved; in the murine HS4 these motifs both contribute to functional enhancer activity (23). In contrast, the BSAP site which upregulates murine HS4 enhancer activity in B cells but downregulates it in pre-B cells is completely absent from the human HS4 sequences.

Lying between HS3 and HS12 in both the 1 and 2 loci are DNase I hypersensitive sites which are not associated with any of the known enhancer elements, but that do map to the position of a 61-bp segment of 70% mouse- human homology. These conserved regions are provisionally designated X sites in part because of their unknown function, and in part because both the human and mouse segments contain XbaI restriction enzyme sites. In mouse this sequence is duplicated as part of the large inverted repeat centered on HS12, so that one copy lies between HS3A and HS12 while a second copy lies between HS12 and HS3B. A segment of (GA)_n repeats is found near the X site in the direction of HS12 at an interval of 80 bp for both mouse X sites (13) and an interval of ~70 bp for the human (data not shown). Within the 61-bp conserved segment, the most highly conserved sequence is a consensus heat shock element (HSE; 41, 42). An HSE could potentially bind heat shock transcription factors (HSTFs), which are known to activate several heat shock response genes (HSP70, HSP90) in response to cellular stress such as heating (43). Fragments containing an X site do not appear to dramatically affect enhancer activity in HS Sultan, but may contribute to regulation through mechanisms not captured in our transient transfection assays.

Discussion

Structure of Human 3  Regions: Evolutionary Implications.

The enhancers clustered 3 of C in the mouse IgH locus can activate the upstream genes, functioning as an LCR. In human IgH locus, arrays of enhancers homologous to those 3 of mouse C are located at two positions within the human IgH locus, 3 of each C gene. On the basis of sequence homology and conservation of restriction sites between the two human enhancer arrays, it is apparent that these enhancers lie near the 3 ends of the two duplication units which encompass the 3-1--1 and 2-4--2 gene clusters (25), indicating that the 3 enhancer arrays were present in an approximation of the human arrangement preceding the duplication event that gave rise to the present human IgH locus structure. Moreover, the arrangement downstream of both human C genes is 5-HS3-HS12-HS4-3, in contrast to the large palindromic structure downstream from mouse C that contains a 5-HS3A-HS12-HS3B-HS4-3 arrangement (13). Therefore, although an arrangement containing an HS3 enhancer proximal to the C membrane exon and an HS4 enhancer farther downstream would seem to have been present in the common ancestor of rodents and primates, the