|
||
Converting Enzyme in Transgenic Mice Prevents Neuronal
Cell Death Induced by Trophic Factor Withdrawal and
Ischemic Brain Injury
By



From the * Cardiovascular Research Center, Department of Medicine,
Neurosurgical Service,
Department of Surgery, and § Stroke and Neurovascular Regulation, Neurosurgical Service,
Department of Surgery, and Neurology Department, Massachusetts General Hospital, Harvard
Medical School, Charlestown, Massachusetts 02129; and the
Manitoba Institute of Cell Biology,
Manitoba Cancer Treatment and Research Foundation, University of Manitoba, Winnipeg,
Manitoba R3EOV9, Canada
To explore the role of the interleukin (IL)-1
converting enzyme (ICE) in neuronal apoptosis, we
designed a mutant ICE gene (C285G) that acts as a dominant negative ICE inhibitor. Microinjection of the mutant ICE gene into embryonal chicken dorsal root ganglial neurons inhibits trophic
factor withdrawal-induced apoptosis. Transgenic mice expressing the fused mutant ICE-lacZ
gene under the control of the neuron specific enolase promoter appeared neurologically normal. These mice are deficient in processing pro-IL-1
, indicating that mutant ICEC285G blocks
ICE function. Dorsal root ganglial neurons isolated from transgenic mice were resistant to
trophic factor withdrawal-induced apoptosis. In addition, the neurons isolated from newborn
ICE knockout mice are similarly resistant to trophic factor withdrawal-induced apoptosis. After
permanent focal ischemia by middle cerebral artery occlusion, the mutant ICEC285G transgenic
mice show significantly reduced brain injury as well as less behavioral deficits when compared
to the wild-type controls. Since ICE is the only enzyme with IL-1
convertase activity in mice, our data indicates that the mutant ICEC285G inhibits ICE, and hence mature IL-1
production, and through this mechanism, at least in part, inhibits apoptosis. Our data suggest that
genetic manipulation using ICE family dominant negative inhibitors can ameliorate the extent
of ischemia-induced brain injury and preserve neurological function.
Apoptosis or programmed cell death is a cellular suicide
mechanism under internal cellular control (1, 2). The
genetic control of programmed cell death is best understood in the nematode Caenorhabditus elegans (3). Mutations
in the gene ced-3 eliminate essentially all programmed cell
death that occur during the development of C. elegans (4).
Genetic mosaic analysis showed that ced-3 acts cell autonomously to induce cell death and thus, ced-3 is an essential
component in the cellular suicide mechanism of C. elegans
(5). Members of the IL-1 Traditionally, ischemia-mediated neuronal cell death has
been attributed to necrosis, rather than to apoptosis. This is
based on the morphological feature of dying neurons of postischemic brain that include swelling and disintegration of
cell membrane, rather than typical cellular shrinkage and
nuclear changes seen in apoptosis. Recently, however, the
conventional view that necrosis is the major, if not the
only, mechanism of ischemia-mediated neuronal degeneration has been challenged. Evidence of activation of apoptotic mechanisms in postischemic cerebral tissue of adult animals has been detected. Internucleosomal cleavage of
DNA has been observed both after global (9, 10) and focal
(11) occlusions. These studies suggest that apoptosis
may play an important role in postischemic neuronal cell
death. It is not clear, however, which are the genetic and
biochemical pathways mediating neuronal apoptotic cell
death induced by ischemic insult.
While the critical role of ICE-like proteases in apoptosis
has been well established, the role of ICE itself in apoptosis remains controversial. ICE knock out mutant mice generated by gene targeting techniques were found to be only
partially defective in apoptosis induced by anti-Fas antibody (14). On the other hand, we and others have found
elevated levels of mature IL-1 Microinjection of Construction of NSE-M17Z Plasmid and Generation of Transgenic
Mice.
pNSE-M17Z-lacZ construct was made by digesting
pNSE-lacZ with SalI and ClaI, which removed a 0.8-kb SalI/
ClaI fragment. The SalI/ClaI digested pNSE-lacZ vector was ligated with a 2-kb SalI/ClaI insert from BSM17Z that contains
the mutant ICE (C285G) and the part of lacZ that was removed
in the SalI/ClaI digest of the pNSE/lacZ vector. The resulting
construct was named pJ655. To generate transgenic mice, pJ655
was linearized by XmnI digestion and gel purified. 14 transgenic
mice lines were generated by DNX (Princeton, NJ). Founder
mice were SV-129/C57BL/6 hybrid. Initially, five lines were selected (7506, 7512, 7516, 7538, and 7539) based on highest DNA copy number in the genome.
Genotyping and X-galactosidase Assay of M17Z Mice.
Tail DNA
was isolated and genotyping was performed using the following PCR primers targeted to the Ice/lacZ fusion (M17Z-F: 5 Facial Nucleus Neuronal Count.
Facial motorneurons were counted
as described by Martinou et al. (22). Briefly, 40 µm brainstem sections of 6-wk-old mice were stained with cresyl violet. Neurons
were counted double blindly in both facial nuclei. All sections
were counted and no correction was applied.
Pro-IL-1 Newborn DRG Neuron Trophic Factor Deprivation.
The experiments were performed as described by Friedlander et al. (19).
Postnatal day 1 mouse DRG neurons were isolated, dissociated
with trypsin for 1 h at 37°C, and plated in an eight-chamber poly-
L-lysine/laminin- (Sigma Chemical Co.) coated slide. Wells were
seeded at a density of ~1,000 neurons/well (eight wells/mouse). Neurons were cultured in Ham's F-12 media supplemented with
20% FCS (BioWhittaker, Inc., Walkersville, MD), NGF (200 ng/ml) (Sigma Chemical Co.), brain-derived neurotrophic factor
(100 ng/ml; Preprotech, Rocky Hill, NJ), glutamine (2 mM),
and penicillin/streptomycin. The medium was replaced with either trophic factor-containing medium (TF[+] = 20% FCS and
200 ng/ml NGF) or trophic factor-deficient medium (TF[ Permanent Middle Cerebral Artery Occlusion.
Experiments were
done as described by Hara et al. (23), except that the occlusion of
the middle cerebral artery (MCA) was continuous for 24 h. Neurological grading: 0, no neurological deficits; 1, failure to extend
the right forepaw; 2, circling to the contralateral side; 3, loss of
walking or righting reflex. All experiments were done in a double-blinded fashion. Values shown as mean ± SEM.
Survival of DRG neurons
in culture requires the presence of trophic factors which include nerve growth factor and serum. In the absence of trophic factor support, DRG neurons undergo apoptosis (24). To
determine whether the mutant ICE can inhibit DRG neuronal death induced by trophic factor deprivation, primary
cultures of chicken embryonic DRG neurons were microinjected with a construct of the fused mutant ICEC285G-lacZ
gene under the control of the
To determine whether the mutant ICE
gene can also act as an inhibitor of apoptosis in vivo, and to
further evaluate its mechanism of action, we established
transgenic mouse lines expressing the fused mutant ICEC285GlacZ gene under the control of the NSE promoter (NSEM17Z). Transgenic mice expressing either the lacZ or bcl-2
genes under control of the NSE promoter have been well
characterized, and transgene expression has been detected
throughout the nervous system (22, 25, 26). PCR was used
for genotyping the NSE-M17Z transgenic mice, and protein expression was detected by X-gal staining (Fig. 2).
Founder mice from five different lines were crossed with
C57BL/6 mice. The expression of NSE-M17Z was detected in the first and second generations of offspring,
which were used in the experiments described below.
NSE-M17Z mice are viable and their embryonic
development appears normal. Developmental apoptosis
does not appear to be inhibited in these mutant ICEC285G
transgenic mice, as evidenced by equal brain size, normal
behavior, as well as equal number of neurons in the facial
motor nucleus, when compared to their wild-type littermates (wild type [n = 6] 2,323 ± 77, transgenic [n = 6]
2,355 ± 84). The lack of an embryonic phenotype in the
mutant ICEC285G mice suggests that mutant ICE does not
block neuronal apoptosis during development. Alternatively, since the NSE promoter is active at low levels during embryogenesis, the expression of the mutant ICE gene
might not reach a threshold sufficient to block developmental cell death (25).
We next evaluated whether the mutant ICEC285G
may act as a dominant negative ICE inhibitor. ICE knockout mice were almost completely defective in processing
pro-IL-1
We have previously demonstrated that a CrmA-sensitive pathway, as well as ICE activation followed by endogenously produced mature IL-1
To determine if ICE plays a role in apoptosis induced by ischemic insult and if the mutant ICEC285G
may act to reduce ischemic brain injury, we investigated
whether the mutant ICEC285G transgenic mice were protected in a mouse focal cerebral ischemia model where apoptotic cell death has been reported (27). We performed permanent MCA occlusion in 14 wild-type and 11 transgenic mice, progeny of five different founder mice (7509, 7512, 7516, 7538, and 7539). Mice were scored neurologically
30 min and 24 h after the occlusion. In the initial 30 min
evaluation, there was no significant difference in the neurological score. During the ensuing 24 h, however, wild-type
mice remained impaired, while transgenic mice improved
neurologically (Fig. 5 A). Mice were killed at 24 h, and infarct volume was quantified with 4% 2,3,5-triphenyltetrazolium chloride. Infarct volume was significantly smaller in
NSE-M17Z (66 ± 11 mm3 [n = 11]) when compared to
the wild-type littermate mice (125 ± 5 mm3 [n = 14]; Fig. 5
B). Physiologic parameters were recorded in a separate set
of transgenic and wild-type mice. Blood pressure, arterial
blood gases (PO2, PCO2, and blood pH), regional cerebral blood flow, and body temperature did not significantly differ in the two sets of mice, before and throughout 30 min of ischemia (Fig. 5 C). Thus, expression of mutant ICEC285G, a
dominant negative inhibitor of ICE, protects neurons from ischemic insult.
We show here that the mutant ICEC285G inhibits apoptosis
in two different species (chicken and mouse) and under the
control of two different promoters ( We determined the role of ICE-like proteases in apoptosis induced by cerebral ischemia in a mouse permanent focal stroke model. We found that NSE-M17Z transgenic
mice suffered less tissue injury and less behavioral changes
as a result of ischemic injury, compared to the wild-type
mice. Although we cannot rule out the possibility that the
reduction of neuronal damage by mutant ICE is due to its
ability to inhibit other members of the ICE family, evidence suggests that ICE itself plays an important role in cerebral ischemia-induced cell death. Elevated levels of IL-1
converting enzyme (ICE)1 family are mammalian homologues of the C. elegans ced-3 gene product (6). Microinjection of crmA, a serpin encoded by
the cowpox virus that is a specific inhibitor of ICE, inhibited neuronal cell death induced by trophic factor deprivation (7). Peptide inhibitors of the ICE family delay motor
neuron death in vitro and in vivo (8). Thus, the ICE protease family plays an important role in mammalian neuronal
apoptosis.
after apoptotic cell death
indicating activation of ICE in apoptosis, since ICE is likely
the only enzyme in vivo and in vitro with IL-1
convertase activity (14). We have previously demonstrated that
binding of endogenously produced mature IL-1
to its
type 1 receptor plays an important role in apoptosis (19). We
have shown that replacing the cysteine in the active site of
ICE with a glycine (C285G) obliterates its ability to mediate cell death (20). The cysteine residue in the active site is
required for the IL-1
convertase and the autoprocessing
activity of ICE (21). We demonstrate here that ICEC285G
mutant is a dominant negative inhibitor of ICE that can
inhibit processing of pro-IL-1
by ICE in vivo. Expression
of mutant ICEC285G in dorsal root ganglial (DRG) neurons,
either by microinjection or in transgenic mice, inhibits
trophic factor withdrawal-induced apoptosis. In addition,
DRG neurons of ICE knockout mice are also resistant to
trophic factor deprivation-induced apoptosis, consistent with
the notion that mutant ICEC285G inhibits ICE directly. Finally, we show here that transgenic mice expressing the
ICEC285G mutant under the control of neuron specific enolase (NSE) promoter are resistant to neuronal injury induced by cerebral ischemia.
-Actin-M17Z into Chicken Embryonic DRG
Neurons.
The experiments were performed essentially as described by Gagliardini et al. (7). Primary cultures of chicken
embryonic DRG neurons were isolated under sterile conditions
from day 10 embryos (Spafas Inc., Preston, CT). DRGs were dissociated by incubation in trypsin for 15 min at 37°C and trituration. Dissociated neurons were plated on poly-L-lysine- (30 mg/ml
for 1 h; Sigma Chemical Co., St. Louis, MO) and laminin-
(Sigma Chemical Co.; 20 mg/ml for 2 h) coated chamber slides.
DRG neurons were cultured for 2 d in F12 medium (GIBCO BRL,
Gaithersburg, MD) containing 10% fetal bovine serum (Hyclone
Labs., Logan, UT), penicillin (100 U/ml; GIBCO BRL), streptomycin (100 mg/ml; Sigma Chemical Co.), and 5 mM cytosine
-D-arabinose (Sigma Chemical Co.) supplemented with nerve
growth factor (NGF; 10 ng/ml; Sigma Chemical Co.). Neuron
injection was performed with a microinjector (model 5242; Eppendorf Inc., Fremont, CA), with glass micropipettes loaded with
1 mg/ml plasmid DNA in Tris/EDTA buffer and 5% rhodamine dye (10 kD rhodamine-isothiocyanite-labeled dextran; Molecular Probes Inc., Eugene, OR), dissolved in 0.2 M KCl. The construction of the fused mutant ICE (C285G)-lacZ plasmid (
-actinM17Z) was described by Miura et al. (20). 3 h after injection, the
NGF-containing medium was replaced with NGF- and serumfree medium in the presence of sufficient mouse monoclonal antibody against NGF (Boehringer Mannheim, Indianapolis, IN).
The medium was changed daily. Live injected neurons were
counted on days 0, 3, and 6.
TGCCCAAGCTTGAAAGACAAGCCC3
, lacZ-R: 5
CTGGCGAAAGGGGGATGTGCTG3
). X-gal staining was performed by removing the vertebral column and sectioning it in a
sagital plane. Tissue was fixed for 5 min on ice (0.2% glutaraldehyde in 0.1 M phosphate buffer, 2% formaldehyde, 5 mM EGTA,
pH 7.3, 2 mM MgCl2) followed by three 30 min washes at 4°C
(0.1 M phosphate buffer, pH 7.3, 2 mM MgCl2, 0.1% sodium deoxycholate, 0.2% NP40). The tissue was then stained overnight with X-gal at 37°C (rinse solution with 1 mg/ml X-gal in
DMSO, 5 mM K ferrocyanide, 5 mM K ferricyanide), and then
sectioned in a cryostat (40 µm). Photomicrograph was taken in a
light microscope (×100) under oil immersion.
Processing After Systemic LPS Administration.
LPS from
Escherichia coli serotype 0111:B4 was dissolved in 0.1 M PBS (pH
7.4). Each mouse (transgenic 29.5 ± 1.2 g, n = 11; wild type
29.6 ± 2.1 g, n = 7) was injected intraperitoneally either with 10 µg of LPS/g body weight, or with equivalent volume of PBS at 0 and 12 h, and killed by decapitation under halothane anesthesia 2 h
after the second injection. Brains were rapidly dissected and frozen in 1.5 ml Eppendorf tubes in liquid nitrogen. Brain tissue
concentration of mature IL-1
was determined in duplicate using
an ELISA kit (IntertestTM-1
X, Lot B6499F; Genzyme Corp.,
Cambridge, MA). Brains without olfactory bulbs and cerebellum
were homogenized in two volumes of ice-cold 0.1 M PBS containing 2 mM phenylmethylsulfonylfluoride, 1 µg/ml leupeptin, 1 µg/
ml antipain, 1 µg/ml aprotinin, 1 µg/ml pepstatin, 0.05% (wt/
vol) sodium azide and 4 mM ethylenediaminetetraacetic acid using a microtube homogenizer (Sigma Pellet Pestle; Sigma Chemical Co.) for 15 s. The homogenates were centrifuged for 30 min
at 50,000 g, and 100 µl of the supernatant was used for each determination. Absorbance was read at 450 nm with an ELISA plate reader (Multiskan MCC/340 MK II; Titertek, Elfab Oy, Finland). Values shown are as mean ± SEM.
] = serum- and NGF-free medium in the presence of a saturating
concentration of mouse NGF monoclonal antibody (100 ng/ml;
Boehringer Mannheim).
Mutant ICE Protects DRG Neurons from Trophic Factor
Withdrawal-induced Apoptosis.
-actin promoter (
-actinM17Z). Neurons were co-injected with rhodamine-isothiocyanate dextran as a marker and with Hoechst dye to
determine neuronal nuclear morphology. After trophic factor removal, control neurons microinjected with the
-actinlacZ construct survived 22.5 and 6.0% after 3 and 6 d in
culture, respectively. No significant difference was detected
when compared to cells injected with dye alone. In contrast, neurons injected with
-actin-M17Z survived 85.0 and 81.0% after 3 and 6 d in culture, respectively (Fig. 1).
These results showed that the mutant ICE gene inhibits
DRG neuronal cell death induced by trophic factor deprivation, suggesting that mutant ICE may be able to suppress
the activities of wild-type ICE or ICE-like proteases.
Fig. 1.
Microinjection of
-actin-M17Z protects embryonic chicken
DRG neurons from trophic factor withdrawal-induced apoptosis. Survival represents the percentage of injected E10 chick DRG neurons remaining alive at 3 and 6 d (100% at day 0) after trophic factor deprivation. A
total of 783 neurons were injected with vector alone (solid bar), 421 with
dye alone (empty bar), and 850 with
-actin-M17Z (hatched bar). Each
condition was done on at least four independent experiments. Results are
expressed as means ± SEM.
[View Larger Version of this Image (25K GIF file)]
Fig. 2.
(a) X-gal staining of a DRG from transgenic 6-wk-old mouse progeny of the 7539 founder (progeny of the 7512 founder had similar staining pattern). (b) PCR genotyping of transgenic lines. M17Z is the original NSE-M17Z plasmid which was used to make the transgenic mouse, used here as a PCR positive control.
7512 and 7539 are positive transgenic lines.
[View Larger Versions of these Images (142 + 31K GIF file)]
and ICE is the only protease identified so far
that can process pro-IL-1
(14, 17). If the mutant ICE
transgenic mice have a defect in secreting mature IL-1
,
this would provide strong evidence that mutant ICEC285G
can act as a dominant negative inhibitor of ICE. Systemic
injection of LPS induces release of mature IL-1
, and ICE
knockout mice generated by gene-targeting technique were
unable to release mature IL-1
upon LPS stimulation (14,
17). To determine if our mutant ICEC285G transgenic mice
are also defective in secreting mature IL-1
, we injected
LPS intraperitoneally into the mutant ICEC285G transgenic
mice and determined the levels of mature IL-1
in whole
brain lysates using an ELISA kit which specifically detects mature IL-1
. After the systemic LPS challenge, whole brain
lysates of mutant ICEC285G transgenic mice contained 74.7%
less mature IL-1
as compared to that of LPS-injected wildtype mice. In control wild-type mice injected intraperitoneally with PBS, there was low but detectable levels of
mature IL-1
in the brain (4.0 pg/g brain), whereas this
cytokine was undetectable in the brain lysate of PBS-injected mutant ICEC285G mice (Fig. 3). Thus, mutant ICEC285G can
act as an effective inhibitor of pro-IL-1
processing, strongly suggesting that mutant ICEC285G is a dominant negative inhibitor of ICE itself.
Fig. 3.
Whole brain lysates of NSE-M17Z mice are deficient in processing pro-IL-1
after systemic LPS administration. LPS was injected intraperitoneally (10 µg/g body weight) and 2 h before killing (wild type,
n = 4; NSE-M17Z, n = 5). PBS was injected as a control (wild type, n = 3;
NSE-M17Z, n = 6). Brains were dissected, and mature IL-1
concentration was determined using an ELISA kit specific for mature IL-1
. Results are expressed as means ± SEM.
[View Larger Version of this Image (14K GIF file)]
receptor binding, play important roles in trophic factor
withdrawal-mediated DRG neuron apoptosis (7, 19). In
this same model, we investigated whether DRG neurons
isolated from mutant ICEC285G mice were resistant to cell
death. DRG neurons were isolated from newborn mutant
ICEC285G transgenic and wild-type mice, and cultured in
the presence or absence of trophic factor. The survival of
wild-type and NSE-M17Z mice DRG neurons in the
presence of trophic factor were >95% after 24 h in culture.
Removal of trophic factor induces 79.7% of neurons to die
within 24 h. DRG neurons from two transgenic lines (7512 and 7539) were significantly protected from apoptosis in
culture (48.6% cell death in 24 h) after trophic factor removal as compared to their wild-type littermates (Fig. 4 a).
If resistance of DRG neurons isolated from mutant ICEC285G
mice to trophic factor deprivation-induced apoptosis can
be attributed to the ability of mutant ICE to inhibit endogenous ICE activity, a prediction would be that DRG neurons from ICE knockout mice should also be resistant to
neuronal cell death induced by trophic factor deprivation.
To test this hypothesis, we examined whether DRG neurons from ICE knockout mice are also protected from
trophic factor withdrawal-mediated apoptosis. Newborn
DRG neurons were isolated from mutant ICE knockout and
control wild-type mice. As shown in Fig. 4 b, DRG neurons isolated from ICE knockout mice are similarly resistant to
cell death induced by trophic factor deprivation as our mutant ICEC285G transgenic mice. These results suggest that
mutant ICEC285G acts as a dominant negative inhibitor of ICE
for the suppression of DRG neuronal cell death-induced
apoptosis and that ICE plays an important role in DRG
neuronal cell death induced by trophic factor deprivation.
Fig. 4.
Survival in vitro of NGF-dependent DRG neurons isolated
from (a) mutant ICEC285G transgenic and (b) ICE knockout newborn mice
are protected from trophic factor withdrawal-mediated apoptosis. Survival represents the percentage of neurons remaining alive after 24 h of
serum deprivation (100% at day 0). (a) The results are the average three double blindly scored independent experiments using newborn mice from lines 7512 and 7539. Neurons from each mouse were plated separately, and at least 400 neurons were counted per well. Results are expressed as means ± SEM. (b) Results are from an experiment double
blindly scored performed in quadruplicate, from DRG neurons isolated
from four wild-type and four ICE knockout newborn mice. At least 500 neurons were counted per well. Results are expressed as means ± SD.
[View Larger Versions of these Images (14 + 15K GIF file)]
Fig. 5.
Protection from permanent MCA occlusion-mediated infarct
in NSE-M17Z (black) compared to wild-type (white) mice. (A) Neurological grading 30 min and 24 h after occlusion. Neurological grading: 0, no
neurological deficits; 1, failure to extend the right forepaw; 2, circling to
the contralateral side; 3, loss of walking or righting reflex. (B) Infarct area
assessed at 24 h. (C) Regional cerebral blood flow (rCBF), and mean arterial blood pressure (MBP) of wild-type and transgenic mice during 30 min
of ischemia (**, P <0.01).
[View Larger Version of this Image (18K GIF file)]
-actin and NSE). We
presented convincing evidence that mutant ICEC285G acts as
a dominant negative inhibitor of ICE by inhibiting processing of pro-IL-1
. X-ray crystallography analysis showed
that ICE exists as a dimer of two p20 and two p10 subunits
processed from two p45 precursor molecules (28). Expression of a catalytically inactive mutant of ICE may result in
formation of inactive dimers which will inhibit endogenous
wild-type ICE function. Since DRG neurons from ICE
knockout mice were protected from trophic factor deprivation-induced apoptosis as were DRG neurons from NSEM17Z transgenic mice, we believe that, at least in DRG
neurons, the mutant ICEC285G prevented neuronal cell death
by inhibiting ICE activity. This is consistent with our previous data that demonstrate that the addition of the IL-1
receptor antagonist, a naturally existing IL-1
antagonist,
inhibited mouse DRG neuronal cell death induced by
trophic factor deprivation, suggesting that release of mature IL-1
processed by ICE plays an active role in apoptosis
induced by trophic factor deprivation (19).
are detected after cerebral ischemia (29). In addition, intraventricular administration of the IL-1 receptor antagonist
decreases infarct size after permanent MCA occlusion (30).
We have also demonstrated that endogenously produced
mature IL-1
plays an important role in hypoxia-mediated apoptosis in vitro (19). These results suggest the involvement of ICE and of mature IL-1
receptor binding in the
mechanism of ischemia-induced cell death. Our results further corroborate the notion that ICE plays an important
role in apoptosis induced by ischemic injury. After exposure to certain death stimuli, the ICE cell death cascade is
activated. As demonstrated here, and in previous studies,
apoptosis may be inhibited by blocking the ICE cell death
cascade, either the activation of pro-ICE, the function of
active ICE, or the product of ICE activity which is mature
IL-1
(7, 19, 31). We cannot rule out, however, that mutant ICEC285G may also cross-inhibit other cell death gene
products, since subunits of different ICE family members
sharing significant sequence homology may bind to each
other forming heterooligomeres (21). Due to the limited
availability of the ICE knockout mice to us, we were unable
to examine directly if the ICE knockout mice are resistant
to ischemic injury. Since embryonic development of the mutant ICEC285G and of ICE knockout mice are normal and
no significant defect in embryonic apoptosis was uncovered
(14, 17), a nonredundant function of ICE in developmental
apoptosis has been ruled out. We demonstrated here that
transgenic mice expressing a dominant negative mutant ICE
are significantly protected from neuronal cell death induced
by ischemic insult, suggesting that ICE may play an important role in pathological cell death. Our results suggest that
ischemic-induced injury, and possibly other disorders featuring apoptosis, can be treated with inhibitors aimed at
modulating the activity of the ICE protease family to reduce tissue injury and preserve brain function.
Address correspondence to Junying Yuan, Department of Cell Biology, 240 Longwood Ave., Harvard Medical School, Boston, MA 02115.
Received for publication 4 November 1996.
J. Yuan was supported in part by grants from the National Institute of Aging, National Institute of Neurological Disorders and Stroke, and Bristol Myer-Squibb. R.M. Friedlander was supported by a postdoctoral training fellowship from National Institutes of Health and by an Upjohn sponsored award from the Joint Section on Cerebrovascular Surgery (Congress of Neurological Surgeons and the American Association of Neurological Surgeons) and from American Brain Tumor Association. M.A. Moskowitz, H. Hara, and K.B. Fink were supported by a grant from the National Institute of Neurological Disorders Interdepartmental Stroke Program Project (NS10828). K.B. Fink was supported by the Deutsche Forschungs Gemelnschaft (F:600/2-1). M.C. Fishman and W. Li were supported by a grant from Bristol Myer-Squibb. A.H. Greenberg and G. MacDonald were supported by a grant from the National Cancer Institute of Canada and the Medical Research Council of Canada.
converting enzyme; MCA, middle cerebral artery; NGF, nerve growth
factor; NSE, neuron specific enolase.
We thank Dr. Winnie Wong of BASF for permission to use ICE knockout mice for DRG experiments. We thank Dr. O. Isacson for help with the histological sections.
| 1. | Wyllie, A.H., J.F.R. Kerr, and A. Currie. 1980. Cell death: the significance of apoptosis. Int. Rev. Cytol. 68: 251-306 [Medline] . |
| 2. | Yuan, J.. 1995. Molecular control of life and death. Curr. Opin. Cell Biol. 7: 211-4 [Medline] . |
| 3. | Ellis, H.M., and H.R. Horvitz. 1986. Genetic control of programmed cell death in the nematode C. elegans. Cell. 44: 817-829 [Medline] . |
| 4. | Ellis, R.E., J.Y. Yuan, and H.R. Horvitz. 1991. Mechanisms and functions of cell death. Annu. Rev. Cell Biol. 7: 663-698 . |
| 5. | Yuan, J.Y., and H.R. Horvitz. 1990. The Caenorhabditis elegans genes ced-3 and ced-4 act cell autonomously to cause programmed cell death. Dev. Biol. 138: 33-41 [Medline] . |
| 6. |
Yuan, Y.,
S. Shaham,
S. Ledoux,
H.M. Ellis, and
H.R. Horvitz.
1993.
The C. elegans cell death gene ced-3 encodes a
protein similar to mammalian interleukin-1 -converting enzyme.
Cell.
75:
641-652
[Medline]
.
|
| 7. |
Gagliardini, V.,
P.A. Fernandez,
R.K.K. Lee,
H.C.A. Drexler,
R.J. Rotello,
M.C. Fishman, and
J. Yuan.
1994.
Prevention of vertebrate neuronal cell death by the crmA gene.
Science (Wash. DC).
263:
826-828
|
| 8. | Milligan, C.E., D. Prevette, H. Yaginuma, S. Homma, C. Cardwell, L.C. Fritz, K.J. Tomaselli, R.W. Oppenheim, and L.M. Schwartz. 1995. Peptide inhibitors of the ICE protease family arrest programmed cell death of motorneurons in vivo and in vitro. Neuron. 15: 385-393 [Medline] . |
| 9. | Heron, A., H. Pollard, F. Dessi, J. Moreau, F. Lasbennes, Y. Ben-Ari, and C. Charriaut-Marlangue. 1993. Regional variability in DNA fragmentation after global ischemia evidenced by combined histological and gel electrophoresis observations in the rat brain. J. Neurochem. 61: 1973-1976 [Medline] . |
| 10. | MacManus, J.P., A.M. Buchan, I.E. Hill, I. Rasquinha, and E. Preston. 1993. Global ischemia can cause DNA fragmentation indicative of apoptosis in rat brain. Neurosci. Lett. 164: 89-92 [Medline] . |
| 11. |
Linnik, M.D.,
R.H. Zobrist, and
M.D. Hatfield.
1993.
Evidence supporting a role for programmed cell death in focal
cerebral ischemia in rats.
Stroke.
24:
2002-2008
|
| 12. | Tominaga, T., S. Kure, K. Narisawa, and T. Yoshimoto. 1993. Endonuclease activation following focal ischemic injury in the rat brain. Brain Res. 608: 21-26 [Medline] . |
| 13. | MacManus, J.P., I.E. Hill, Z.G. Huang, I. Rasquinha, D. Xue, and A.M. Buchan. 1994. DNA damage consistent with apoptosis in transient focal ischaemic neocortex. Neuroreport. 5: 493-496 [Medline] . |
| 14. |
Kuida, K.,
J.A. Lippke,
G. Ku,
M.W. Harding,
D.J. Livingston,
M.S.S. Su, and
R.A. Flavell.
1995.
Altered cytokine export and apoptosis in mice deficient in interleukin-1 converting enzyme.
Science (Wash. DC).
267:
2000-2002
|
| 15. |
Hogquist, A.H.,
M.A. Nett,
E.R. Unaune, and
D.D. Chaplin.
1991.
Interleukin 1 is processed and released during apoptosis.
Proc. Natl. Acad. Sci. USA.
88:
8485-8489
|
| 16. | Zychlinsky, A., C. Fitting, J.M. Cavaillon, and P.J. Sansonetti. 1994. Interleukin 1 is released by murine macrophages during apoptosis induced by Shigella flexneri. J. Clin. Invest. 94: 1328-1332 . |
| 17. |
Li, P.,
H. Allen,
S. Banerjee,
S. Franklin,
L. Herzog,
C. Johnston,
J. McDowell,
M. Paskind,
L. Rodman,
J. Salfeld, et al
.
1995.
Mice deficient in IL-1 -converting enzyme are deficient in production of mature IL-1 and resistant to endotoxic shock.
Cell.
80:
401-411
[Medline]
.
|
| 18. |
Miura, M.,
R.M. Friedlander, and
J. Yuan.
1995.
Tumor necrosis factor-induced apoptosis is mediated by a CrmA-sensitive cell death pathway.
Proc. Natl. Acad. Sci. USA.
92:
8318-8322
|
| 19. |
Friedlander, R.M.,
V. Gagliardini,
R.J. Rotello, and
J. Yuan.
1996.
Functional role of interleukin-1 (IL-1 ) in IL-1 -
converting enzyme-mediated apoptosis.
J. Exp. Med.
184:
717-724
|
| 20. |
Miura, M.,
H. Zhu,
R. Rotello,
E.A. Hartweig, and
J. Yuan.
1993.
Induction of apoptosis in fibroblasts by IL-1 -converting enzyme, a mammalian homologue of the C. elegans cell
death gene.
Cell.
75:
653-660
[Medline]
.
|
| 21. |
Gu, Y.,
J. Wu,
C. Faucheu,
D.J. Livingston, and
M.S.S. Su.
1995.
Interleukin-1 converting enzyme requires oligomerization for activity of processed forms in vivo.
EMBO (Eur.
Mol. Biol. Organ.) J.
14:
1923-1931
[Medline]
.
|
| 22. | Martinou, J.C., M. Dubois-Dauphin, J.K. Staple, I. Rodriguez, H. Frankowski, M. Missotten, P. Albertini, D. Talabot, S. Catsicas, C. Pietra, and J. Huarte. 1994. Overexpression of BCL-2 in transgenic mice protects neurons from naturally occurring cell death and experimental ischemia. Neuron. 13: 1017-1030 [Medline] . |
| 23. | Hara, H., P. Huang, N. Panahian, M.C. Fishman, and M.A. Moskowitz. 1996. Reduced brain edema and infarction volume in mice lacking the neuronal isoform of nitric oxide synthetase after transient MCA occlusion. J. Cereb. Blood Flow Metab. 16: 605-611 [Medline] . |
| 24. |
Davies, A.M..
1987.
Molecular and cellular aspects of patterning sensory connections in the vertebrate nervous system.
Development (Camb.).
101:
185-208
|
| 25. |
Forss-Petter, S.,
P.E. Danielson,
S. Catsicas,
E. Battenberg,
J. Price,
M. Nerenberg, and
J.G. Sutcliffe.
1990.
Transgenic
mice expressing -galactosidase in mature neurons under
neuron-specific enolase promoter control.
Neuron.
5:
187-197
[Medline]
.
|
| 26. |
Farlie, P.G.,
R. Dringen,
S.M. Rees,
G. Kannourakis, and
P. Bernard.
1995.
bcl-2 transgene expression can protect neurons against developmental and induced cell death.
Proc. Natl.
Acad. Sci. USA.
92:
4397-4401
|
| 27. | Li, Y., M. Chopp, N. Jiang, and C. Zaloga. 1995. In situ detection of DNA fragmentation after focal ischemia in mice. Mol. Brain Res. 28: 164-168 [Medline] . |
| 28. |
Wilson, K.P.,
J.-A.F. Black,
J.A. Thomson,
E.E. Kim,
J.P. Griffith,
M.A. Navia,
M.A. Murcko,
S.P. Chambers,
R.A. Aldape,
S.A. Raybuck, and
D.J. Livingston.
1994.
Structure
and mechanism of interleukin-1 converting enzyme.
Nature
(Lond.).
370:
270-275
[Medline]
.
|
| 29. |
Lui, T.,
P.C. Mc,
Donnell,
P.R. Young,
R.F. White,
A.L. Siren,
J.M. Hallenbeck,
F.C. Barone, and
G.Z. Feuerstein.
1993.
Interleukin-1 mRNA expression in ischemic rat cortex.
Stroke.
24:
1746-1751
|
| 30. | Relton, J.K., and N.J. Rothwell. 1992. Interleukin-1 receptor antagonist inhibits ischaemic and excitotoxic neuronal damage in rats. Brain Res. Bull. 29: 243-246 [Medline] . |
| 31. |
Boudreau, N.,
C.J. Sympson,
Z. Werb, and
M.J. Bissell.
1995.
Suppression of ICE and apoptosis mammary epithelial
cells by extracellular matrix.
Science (Wash. DC).
267:
891-893
|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|