|
||
By
From the Department of Immunology and Cell Biology, Cell Genesys Inc., Foster City, California 94404
Gene modification of hematopoietic stem cells (HSC) with antigen-specific, chimeric, or "universal" immune receptors (URs) is a novel but untested form of targeted immunotherapy. A
human immunodeficiency virus (HIV) envelope-specific UR consisting of the extracellular
domain of human CD4 linked to the
chain of the T cell receptor (CD4
) was introduced ex
vivo into murine HSC by retroviral transduction. After transplantation into immunodeficient SCID mice, sustained high level expression of CD4
was observed in circulating myeloid and
natural killer cells. CD4
-transplanted mice were protected from challenge with a lethal dose of
a disseminated human leukemia expressing HIV envelope. These results demonstrate the ability
of chimeric receptors bearing
-signaling domains to activate non-T cell effector populations
in vivo and thereby mediate systemic immunity.
Introduction of therapeutic genes into hematopoietic
stem cells (HSC)1 may be useful for treatment of human
diseases such as HIV infection and cancer. Current gene
therapy strategies for AIDS include "intracellular immunization" (1) in which inhibition of HIV infection or propagation in target cells is mediated through the introduction
of HIV resistance genes into HSC or mature T cells (2),
as well as active immunization with gene-modified cells
expressing HIV antigens (5, 6). Strategies for cancer gene
therapy include active immunization with autologous tumor cells genetically altered ex vivo with immunomodulatory genes, such as costimulatory receptors and cytokines
(7, 8). Many of these approaches rely on active as opposed
to passive immunotherapy, requiring in vivo stimulation of
the host cellular immune system and induction of T cell responses to achieve effective systemic immunity.
In this report, we describe a novel strategy for passive
immunotherapy of infectious or malignant disease involving transplantation of HSC modified ex vivo with diseasespecific chimeric or "universal" immune receptors. Universal
receptors (UR) are HLA-unrestricted chimeric proteins in
which the signaling domain of a native immune receptor is
fused to a heterologous ligand-binding domain. Cytolytic effectors such as myeloid and NK cells arise rapidly after
bone marrow transplantation, and can be specifically directed via URs to diseased cells in vivo. Furthermore, genemodified HSC provide a continuous source of UR-expressing
hematopoietic cells of multiple lineages, which may lead to
prolonged systemic immunity.
To date, reports from our laboratory and others have examined in vitro UR function after modification of mature
T (9) and NK (14) cells. We have previously described
two classes of UR in which the signaling domain of the
TCR- Retroviral Vectors.
The retroviral vector rkat43.3F3 is a variant
of the previously described rkat43.2F3 vector (24) in which an
internal human phosphoglycerol kinase (PGK) promoter has been
inserted upstream of the CD4 HIV-specific CD4 and SAb URs.
The CD4 Animals.
C.B-17 scid/scid (SCID) mice were used for all
transplant studies. Bone marrow donors were 8-16-wk-old male
and female mice obtained from the Cell Genesys in-house SCID
colony. Bone marrow recipients were 8-12-wk-old male SCID
mice procured from an outside vendor (Charles River Laboratories, Wilmington, MA). Animals were housed in sterile laminar
airflow hoods and fed ad lib with sterile food and water. Before
use in transplantation experiments, mice were screened for serum
IgM levels by ELISA as previously described (26). Only mice
with <0.5 µg/ml IgM were used. All animal procedures conformed to institutional guidelines.
Retroviral Transduction and Transplantation of SCID Mice.
Donor
SCID mice were injected via the tail vein with 5-fluorouracil
(100 µg/kg; Roche Laboratories, Hoffmann-La Roche Inc., Nutley,
NJ). 6 d later, mice were killed by CO2 asphyxiation. Femurs
were harvested and flushed with culture medium (DME/4.5 g/liter glucose, 15% FCS, glutamine, penicillin, and streptomycin) + 5 mM EDTA. Low density cells (LDC) were isolated by density gradient separation using Lympholyte-M (Cedarlane Laboratories Ltd., Hornby, Ontario, Canada). Briefly, bone marrow cells were layered over an equal volume of gradient and spun at 2,200 rpm for 20 min at 20°C in a tabletop centrifuge. Interphase cells were
collected, washed, and resuspended in culture media. LDC were
plated at 3 × 106 cells/well of a six-well plate (Corning Glass Inc.,
Corning, NY) and exposed to UR-expressing retroviral supernatant
(CD4 Immunofluorescence Analysis of CD4 Quantitative-Competitive PCR Assay for CD4 PCR Assay for Detection of Raji Cells Expressing HIV-env.
300 µl
of heparinized peripheral blood (PB) was attained by retroorbital
bleeds from eight surviving mice 4 mo after Raji cells expressing
HIV-env (Raji-env) challenge and a control mouse. Ammonium
chloride RBC lysis was performed and recovered cells were washed,
pelleted, and resuspended at 2,000 cell/µl in lysis buffer (1× PCR
buffer [Fisher], 0.1% Tween 20, and 100 µg/ml proteinase K [Boehringer Mannheim]). As a positive control, lysates of 0.1, 1, and 10 cultured Raji-env cells in a background of 104 NIH 3T3 cells were
also prepared. The samples were heated at 55°C for 45 min, followed
by 95°C for 15 min to inactivate the proteinase K. PCR was then
performed using two sets of primers: (a) murine Recovery of Raji-env from Transplanted Mice.
At the time of death
from disseminated leukemia, femoral bone marrow was harvested
from a CD4 Immunofluorescence Analysis of Raji-env.
106 sorted Raji-env cells,
as well as parental Raji cells (Raji-p) and Raji-env cells maintained
in liquid culture, were incubated with mouse anti-gp120 mAb
(New England Nuclear [NEN] Virus Research, Wilmington,
DE) or the isotype-negative control, followed by incubation with
goat anti-mouse biotin F(ab Immunoblot Analysis of Raji-env.
106 sorted Raji-env cells and
cultured Raji-p and Raji-env cells were lysed for 30 min at 4°C
in 10 µl of NP-40 lysis buffer (1% NP-40, 150 mM NaCl, and 10 mM Tris [pH 7.8]). Lysates were subjected to SDS-PAGE, transferred to nitrocellulose membranes, and incubated with antigp120 mAb (NEN Virus Research). Bound Ab was detected
with horseradish peroxidase-conjugated sheep Ab to mouse IgG,
followed by a nonisotopic enhanced chemiluminescence assay
(Amersham, Arlington Heights, IL).
Neutrophil Isolation and Cytotoxicity Assay.
3 wk after transplant, four CD4 The UR CD4 Donor SCID mice were treated with 5-fluorouracil to
enrich for immature hematopoietic progenitors with longterm repopulating ability (30). LDC were isolated and exposed to CD4 Long-term multilineage in vivo expression of the
CD4
Subsequent QC-PCR analysis of PB from five transplanted mice demonstrated levels of integrated provirus
that approximated expression levels determined by immunofluorescence. A representative result is shown in Fig. 1, b
and c. To confirm that our transduction system targeted
long-term repopulating HSC (34), CD4 We next tested the in vivo function of hematopoietic cells
expressing CD4 In the first experiment, SCID mice were transplanted
with CD4
Similar results were observed in a second experiment designed to test the limits of this model by comparing the anti
tumor activity mediated by a high versus a low expressing
UR. Murine bone marrow was transduced with either the
CD4 In the first
experiment, it was noted that death was delayed in the two
CD4
To screen
for residual circulating leukemia cells in surviving CD4
Previous studies from our
laboratory have shown that
We have shown that murine SCID long-term repopulating HSC can be efficiently transduced with the UR CD4 These studies show that a UR that bears the signaling
domain of Many groups, including our own, have focused on T cell
adoptive immunotherapy approaches to the treatment of
viral infections and cancer. The data presented here, using a
SCID model in which functional lymphocytes are absent,
suggest a possible role for the manipulation of myeloid and
NK cells in the treatment of such diseases. It has been shown
that monocytes from HIV+ patients demonstrate significant
ADCC against HIV-infected T cell targets, and that neutrophil and mononuclear cell ADCC is impaired in HIV+
children and adults, suggesting that these effector cells may be important in the setting of HIV infection (43, 44). Furthermore, neutrophils (37), macrophages (45), and
NK cells (48) have been shown to mediate efficient ADCC
of tumor cell targets in vitro. FcR-mediated cytotoxicity
can be enhanced by exposure of effector cells to various hematopoietic cytokines; for example, neutrophil antitumor
ADCC is upregulated by exposure to G-CSF, GM-CSF,
and IFN- Introduction of disease-specific chimeric immune receptors into bone marrow progenitor cells is a novel application of HSC gene therapy which, to date, has focused on
gene-marking studies, introduction of chemotherapy and
HIV-1 resistance genes, and correction of rare single-gene
defects (49, 50). This is the first study demonstrating the efficacy of such an HSC-based immunotherapy approach in
an in vivo model. Gene modification of HSC may be preferable to modification of terminally differentiated effector cells, such as T or NK cells, for several reasons: (a) multiple effector cells can be simultaneously redirected using a stem
cell approach; (b) prolonged in vitro expansion of genemodified cells, which may negatively impact their in vivo
trafficking or function, can be avoided; and (c) a renewable
source of gene-modified effector cells capable of prolonged
antigen-specific immune surveillance may be created. Although the UR model system we have used is targeted to
the HIV protein gp120, chimeric immune receptors may
be tailored to recognize a variety of viral or tumor-associated antigen targets. This stem cell gene therapy approach
could potentially have broad applicability to the field of targeted immunotherapy of malignant disease.
chain (15, 16) is fused either to a single-chain antibody (SAb) specific for the HIV envelope (HIV-env) glycoprotein, gp41, or to the extracellular domain of human
CD4 specific for HIV-env gp120. Both receptors redirect
CD8+ T cells (13) and NK cells (14) to kill HIV-infected
cells and HIV-env-expressing tumors in vitro. Although
the native
chain is primarily associated with the TCR,
the cytoplasmic tails of the Fc receptor (FcR)-
chain and
TCR-
share a conserved 18-amino acid immunoreceptor
tyrosine activation motif (17, 18), and both
and
are
present as homo- and heterodimers in some classes of FcR
(19). This structural similarity suggests that
-bearing URs may also activate FcR-mediated effector functions of
myeloid cells, such as antibody-dependent cellular cytotoxicity (ADCC). Indeed, preliminary work in this laboratory
demonstrates cytolytic activity of CD4
-expressing neutrophils against HIV-env-expressing target cells in vitro (our
unpublished data). To analyze the in vivo function of non-T
cell effector populations bearing
-based URs, we transplanted immunodeficient SCID mice that lacked mature T
and B cells (22, 23) with bone marrow that were retrovirally-transduced with the CD4
UR. Transplanted mice
were analyzed for UR expression and subsequently challenged with a human B cell leukemia stably expressing
HIV-env.
coding sequence. Retroviral supernatants were prepared by transient transfection of human 293 cells with rkat43.3F3 and a plasmid containing packaging functions (pkat) using the kat system (24).
UR was constructed as described previously (13). The HIVgp120-specific SAb
UR was constructed as described for the HIVgp41-specific SAb
UR (13), with the following modification: the extracellular domain of the gp120-SAb
UR was derived from the gp120-specific human mAb, 447-D (25). The cytoplasmic and transmembrane domains are identical to that of CD4
, deriving from
TCR
and CD4, respectively.
or SAb
) containing 8 µg/ml polybrene on plates coated
with rat fibronectin (15 mg/well of six-well plate in PBS; Sigma
Immunochemicals, St. Louis, MO; 27). After 2 h, the medium was
hemidepleted and fresh viral supernatant was added. Viral supernatant was prepared by transfection of 293 cells using the kat system,
as described previously (24). Transduced cells were harvested from
the plates after 4 h, washed, and resuspended in 0.9% NS + 0.1%
BSA for injection. 106 transduced LDC/mouse were infused into
sublethally irradiated (350 rads) SCID mice via tail vein injection.
.
300 µl of heparinized
blood was attained by retroorbital bleeds of CD4
transplanted
and control mice at various time points after transplant. RBCs were
depleted by ammonium chloride lysis. Approximately 2 × 105
cells/stain were incubated with the following murine-specific mAbs conjugated to FITC: anti-GR-1, anti-Mac-3, anti-5E6
(Pharmingen, San Diego, CA) in addition to anti-human CD4-PE
(Becton Dickinson & Co., Mountain View, CA), according to
manufacturer's instructions. FITC- and PE-conjugated isotypematched mAbs served as negative controls. Stained cells were analyzed on a FACScan® cytometer (Becton Dickinson).
.
20,000 RBCdepleted peripheral blood cells isolated from CD4
-transplanted
mice (e
) were combined with known titrations of transduced
competitor cells in which the CD4
construct contained an additional 102-bp insert comprised of the 3
end of the Moloney murine leukemia virus envelope gene (e+). Cell mixtures were
washed, resuspended in 50 µl of lysis buffer (1× PCR buffer
(Fisher Scientific, Pittsburgh, PA), 0.1% Tween 20, 100 µg/ml
proteinase K (Boehringer Mannheim, Indianapolis, IN) and
heated to 55°C for 45 min, followed by 95°C for 15 min. PCR
was performed using a primer set that recognizes the integrated CD4-
construct (upper, 5
AACTGATTGGTTAGTTCAAATAAGGC3
; lower, 5
CCAGACCTGCAGACGCCCAGA3
). 2 µl
of cell lysate was added to 48 µl of PCR reaction mix (25 pmol
each primer, 1× PCR buffer, 1.5 mM MgCl2, 5 U Taq polymerase [Fisher], 50 µM dNTP). Cycling was initiated in a thermocycler (model 9600; Perkin-Elmer Corp., Norwalk, CT,
94°C for 30 s, 60°C for 30 s, 72°C for 30 s, 26 cycles). The PCR
products were electrophoresed through preformed 6% polyacrylamide gels (Novex, San Diego, CA) and resolved by autoradiography.
-actin (upper
5
CGAGCATCCCCCAAAGTTCA-CAA3
; lower 5
CCCAGCCACACCACAAAGTCACA3
) and (b) herv-H (upper 5
ACTATAGGCAACTTTCCACC-CTCC3
; lower 5
GCTACTTGGCTGCCT-CTA-CTCTA3
). Reactions were set up in a 50-µl
vol with 5 µl of cell lysate, 1× PCR buffer, 1.5 mM MgCl2, 25 pmol of each primer, 50 µM dNTP, and 5 U Taq polymerase
(Fisher). Cycling was initiated in a Perkin-Elmer thermocycler
(94°C for 1 min, 60°C for 1 min, 72°C for 2 min, 30 cycles). The
PCR products were electrophoresed through preformed 6%
polyacrylamide gels (Novex) and resolved by autoradiography.
-transduced and a control mouse injected with Rajienv. Bone marrow cells were subjected to ammonium chloride
RBC lysis and then incubated with saturating concentrations of
anti-human CD19-PE (Becton Dickinson) for detection of Rajienv cells. CD19+ Raji-env cells were then sorted using the Becton Dickinson FACStar Plus®. Recovered cells were subjected to
flow cytometric and immunoblot analysis to detect the HIV-env
protein gp120.
)2 (Cappel Laboratories, Durham, NC) and allophycocyanin-streptavidin (APC; Molecular Probes,
Inc., Eugene, OR). APC-stained cells were analyzed using a Becton Dickinson FACStar Plus®.
-transduced and four control mice were treated
with seven daily subcutaneous injections of human G-CSF (100 µg/kg per d; Amgen, Thousand Oaks, CA). Mice were then
killed, and heparinized blood was recovered by cardiac puncture.
Neutrophils were isolated using a modification of the standard
"1-step Polymorph" procedure (Accurate Chemical & Science Corp., Westbury, NY) (28) in which 0.8 ml of 1.5% NaCl was
added to 10 ml of stock gradient. 4 ml of murine PB was layered
over 4 ml of modified gradient, and tubes were spun for 30 min
at 450 g at 20°C in a tabletop centrifuge. The neutrophil fraction
was recovered and washed twice. An aliquot was removed for
cytospin analysis and Wright-Giemsa staining using standard
techniques. Additional cells were removed for measurement of
CD4
transduction efficiency by flow cytometric and quantitative-competitive (QC)-PCR analysis. The remaining cells were
used in a chromium release cytotoxicity assay. Raji-p and Rajienv cells were labeled with sodium [51Cr] chromate (100 µCi/
106 cells) for 3 h at 37°C, washed three times, and resuspended in assay medium (RPMI, 10% FCS, 10 ng/ml murine GM-CSF).
105 51Cr-labeled target cells were plated in duplicate in 96-well
plates together with control or CD4
-expressing neutrophils at
E/T ratios of 250:1-1.2:1. To measure ADCC, polyclonal rabbit
anti-human lymphocyte serum (4 mg/ml; Accurate Chemical & Science Corp.) was added to one row of duplicate wells. Cells were
incubated at 37°C for 4 h. 100 µl of supernatant was removed
from each well and counted in a gamma counter for the assessment
of 51Cr release. The percentage of specific lysis was calculated from duplicate samples using the following formula: (CMP
SR)/
(MR
SR) × 100, where CMP is the cpm released by targets
incubated with effector cells, MR is the cpm released by targets
lysed with 100 µl of 1% Triton X-100, and SR is the cpm released by targets incubated with medium only.
Transplantation of SCID Mice with CD4
-modified Bone
Marrow.
was introduced into bone marrow progenitor cells of SCID mice using retroviral transduction. A high efficiency retroviral transduction system,
kat, was used to generate high titer retroviral supernatants
containing the CD4
construct from 293 cells transiently
transfected with packaging (pkat) and retroviral vector
(rkat) plasmids, as described previously (24). Retroviral titers on NIH 3T3 cells ranged from 6 × 106-107 viral particles/ml. The retroviral vector used, rkat43.3F3, is Moloney
murine leukemia virus based and contains an internal phosphoglycerol kinase (PGK) promoter to minimize loss of
transcriptional activity in vivo (29). After reverse transcription and integration into target cells, transcription is initiated only from the PGK promotor. Previous work in this
laboratory has shown that this vector yields stable levels of
CD4
expression over 6 mo in transplanted C3H mice,
whereas viral long terminal repeat (LTR) driven expression diminishes rapidly over 1-2 mo (our unpublished data).
retroviral supernatant in the presence of rat
fibronectin, which has been shown to increase the efficiency of retroviral gene transfer (27). Transduced cells
were then infused via tail vein injection into sublethally irradiated recipient SCID mice.
in Transplanted
Mice.
UR was achieved after gene transfer into SCID
bone marrow. 3 wk after transplant, mice were analyzed
for transduction efficiency and CD4
expression by QCPCR and flow cytometric analysis of peripheral blood and
bone marrow. In five separate experiments using 20-40 mice each, the mean percentage of PB leukocytes expressing CD4
as measured by immunofluorescence was 39%
(range = 12-70%). Lineage-specific expression of CD4
was measured by double staining with PE-conjugated anti-
human CD4 and FITC-conjugated mAbs specific for various murine blood lineages (Fig. 1 a). These included Mac-3
(found on monocytes, macrophages, and granulocytes; 31),
Gr-1 (expressed on granulocytes; 32), and 5E6 (present on
a subset of NK cells; 33). CD4
expression was highest in
Mac-3+ monocytes and granulocytes, followed by Gr-1
bright mature granulocytes, and 5E6+ NK cells. The absence of circulating CD4+ and CD8+ T cells in these transplanted SCID mice was confirmed by flow cytometry (data
not shown). The percentage of bone marrow cells expressing CD4
averaged 20-40% of that seen in the PB, suggesting that expression of CD4
in hematopoietic cells may
be affected by their state of differentiation.
Fig. 1.
Analysis of CD4
expression in transplanted mice. (a)
Flow cytometric analysis. PB leukocytes from mice 3 wk after transplant were incubated with the following
murine-specific mAbs conjugated to
FITC: anti-GR-1, anti-Mac-3,
anti-5E6 in addition to anti-human CD4-PE. Background human CD4
expression in various lineages in a
control mouse (top) is compared to
human CD4 expression in a CD4
transplanted mouse (bottom). Specific cell staining was measured on
gated populations containing myeloid cells (Gr-1 and Mac-3) and
lymphoid cells (NK5E6), as determined by forward and side scatter
characteristics. Results are representative of those observed in 80 additional mice. (b) QC-PCR analysis.
CD4
-expressing PB cells from a
mouse 3 wk after transplant (e
)
were combined with known titrations of CD4
-transduced competitor cells (e+). The lane in which the
e
and e+ amplification products are
equivalent represents the percentage of PB cells containing the CD4
gene; in this case, ~10%. The corresponding expression level by FACS®
analysis in this mouse was 20%. PB
from an untransplanted mouse serves
as a control. (c) The structure of the
integrated CD4
retroviral vector
and the competing template used in
the QC-PCR assay. The CD4
construct used to generate the e+
competitor cells contains an additional 102-bp sequence to enable differential separation of the PCR
products on gel electrophoresis. The location of the PCR primers
(black arrows) and the expected competing transcripts (e
and e+) are
shown. PGK, human phosphoglycerate kinase promoter.
[View Larger Version of this Image (38K GIF file)]
expression in the
peripheral blood of transplanted mice was monitored during a period of 6 mo. In a cohort of eight mice followed
longitudinally, the mean percentage of peripheral blood
leukocytes expressing CD4
, as measured by immunofluorescence, was 16% (range = 13-19%) at 3 wk, 14% (range = 6-23%) at 4 mo, and 17% (range = 5-28%) at 6 mo.
-expressing Mice Demonstrate Immunity to Raji-env.
by challenging transplanted mice with a
derivative of the human B cell leukemia/lymphoma, Raji,
which stably expresses low levels of the HIV-env proteins
gp120 and gp41 (Raji-env; 14). Since HIV gp120 binds to
human CD4, Raji-env is a specific target for the CD4
UR. Intravenous infusion of Raji-p into SCID mice reproducibly causes a lethal disseminated leukemia that invades the bone marrow, liver, spleen, and central nervous system
(26). Preliminary studies were performed to determine the
optimal tumor dose for subsequent challenge experiments.
Deaths after intravenous infusion of various doses of either
Raji-p or Raji-env were as follows: 107 (17-22 d), 106 (22-
25 d), 105 (30-60 d), 104 (no deaths).
-transduced bone marrow, and 3 wk later were
challenged with 105 or 106 Raji-p or Raji-env cells via tail
vein injection. Transplanted mice were then followed for
the development of hind leg paralysis secondary to central
nervous system invasion and death from disseminated leukemia (Fig. 2 a). In the group receiving 105 Raji-env cells,
8/10 CD4
-expressing mice survived >4 mo after transplant, whereas only 1/10 of the transplanted mice receiving 105 Raji-p cells survived (Fig. 2 a). All untransplanted mice
challenged with either Raji-p or Raji-env died within 60 d.
At the higher leukemia cell dose of 106, CD4
-expressing
mice receiving Raji-env exhibited a 10-40-d delay in
death as compared to Raji-p infused controls, but 9/10 mice died within 80 d (data not shown).
Fig. 2.
Survival of transplanted mice after Raji-env cell infusion. In
two separate experiments, SCID mice were transplanted with UR-transduced bone marrow (CD4
or SAb
). 3 wk after transplant, UR-transduced and control mice were injected via the tail vein with Raji-p or
Raji-env tumor cells. (a) Survival of CD4
mice (10/group) receiving 105
Raji-env (CD4
+R-env) or Raji-p (CD4
+R-p) cells compared to historical control untransplanted mice (5/group) receiving 105 Raji-env
(ctrl+R-env) or Raji-p (ctrl+R-p) cells. Between 4 and 8 mo after transplant, four of the Raji-env survivors died from the spontaneous development of endogenous thymic lymphomas, which is a known complication
of sublethal irradiation in SCID mice (51). (b) Survival of CD4
and SAb
mice (5/group) challenged with 105 Raji-env or Raji-p cells compared
with concurrent control untransplanted mice infused with either tumor
(5/group). SAb
mice infused with 105 Raji-p all died within 50 d.
[View Larger Version of this Image (22K GIF file)]
UR or with a SAb
UR specific for HIV-env gp120
which, in contrast to previous SAb
URs tested (13), is
poorly expressed upon gene transfer. CD4
-transduced mice showed surface human CD4 expression in 29-42% of
circulating leukocytes at 3 wk after transplant, whereas
mice transplanted with the SAb
gene expressed the UR in
only 1-3% of peripheral blood cells by flow cytometry (data
not shown). CD4
, SAb
, and untransplanted control mice
were challenged with 105 Raji-p or Raji-env cells (five per
group, Fig. 2 b). 4/5 CD4
-expressing mice that received
Raji-env cells survived >4 mo after infusion. In contrast,
all five SAb
-transplanted mice succumbed to the disseminated Raji-env leukemia, as did 9/10 control untransplanted mice challenged with either Raji-p or Raji-env,
and all CD4
- and SAb
-transplanted mice receiving Raji-p.
This study confirms the in vivo antitumor activity of
CD4
-bearing hematopoietic cells seen in the first experiment and shows a relative lack of SAb
UR-mediated activity, which is likely secondary to low in vivo expression
levels. Furthermore, this study rules out the possibility that
survival of the CD4
mice challenged with Raji-env is
caused by a nonspecific effect of the radiation or transplant
regimen.
Raji Revertants in Vivo.
-expressing mice that died after challenge with 105
Raji-env cells (Fig. 2 a). To assay for the maintenance of
gp120 expression by Raji-env in vivo, bone marrow was
harvested from one of these mice at the time of death, and
Raji-env cells were isolated by cell sorting using the human
anti-B cell mAb anti-Leu-12 (CD19). Human CD19+ Raji
cells constituted 4% of bone marrow leukocytes at the time of death from disseminated leukemia in this mouse. Recovered Raji-env cells were subjected to a sensitive APC
staining procedure to detect surface expression of HIV
gp120 (Fig. 3 a), as well as immunoblot analysis to detect
total protein (Fig. 3 b). HIV gp120 could not be detected
in these cells by either technique, suggesting that delayed
death of this animal resulted from the outgrowth of Rajienv
revertants. In contrast, Raji-env cells sorted from the
bone marrow of a control mouse at the time of death
maintained stable expression of HIV gp120 by both flow
cytometric and immunoblot analyses (Fig. 3, a and b). In
subsequent experiments, death after infusion of 105 Rajienv cells into CD4
-transplanted mice was associated with a loss of gp120 expression in three out of three mice analyzed.
Fig. 3.
Death of CD4
-transplanted mice after Raji-env infusion is associated with a loss of gp120 expression in vivo. (a) Flow cytometric analysis.
Raji-env cells sorted from the bone marrow of a CD4
-transplanted (CD4
sort) and a control mouse (control sort), as well as Raji-p and Raji-env cells
maintained in liquid culture, were incubated with mouse anti-gp120 mAb to detect surface expression of HIV-env or the isotype-negative control, followed by incubation with goat anti-mouse biotin F(ab
)2 and APC (Molecular Probes). (b) Immunoblot analysis. Sorted Raji-env cells (CD4
sort and
control sort) and cultured Raji-p and Raji-env cells were lysed and subjected to SDS-PAGE, followed by immunoblotting with anti-gp120 mAb to detect the presence of the env protein.
[View Larger Version of this Image (24K GIF file)]
expressing mice challenged with Raji-env, PCR analysis was carried out on PB 4 mo after transplant (Fig. 4). The
PCR assay used a probe specific for a human endogenous
retroviral sequence, Herv-H, which is present in multiple
copies in all human cells (35, 36). The sensitivity of this assay is sufficient to detect a single Raji cell in a background
of 105 murine cells. All surviving mice were PCR negative,
ruling out the presence of minimal residual disease at this
level of detection.
Fig. 4.
PCR analysis of surviving mice shows no evidence
of residual Raji-env. Lysates of
PB were prepared from eight
surviving CD4
-transduced mice
challenged with Raji-env at 4 mo after transplant. DNA was amplified using primers specific
for a 905-bp human endogenous retroviral sequence (Herv-H) to
detect Raji-env DNA (Mouse PB, lanes 1-8). Results are compared
to titrations of cultured Raji-env cells in a background of 104 murine cells amplified with Herv-H
primers (Raji) and Herv-H-amplified PB from a control mouse (con).
Samples were amplified with
murine
-actin primers (447-bp
product) as a positive control
(Mouse PB, lanes 1-3).
[View Larger Version of this Image (50K GIF file)]
-bearing URs can direct the
cytolytic activity of FcR-bearing nonlymphoid effector
cells such as NK cells in vitro (14). Since 70-80% of circulating leukocytes in the SCID mouse are neutrophils (23), we sought to determine whether neutrophils harvested
from UR-transplanted SCID mice could demonstrate tumor-specific cytolytic activity in vitro. In three separate experiments, neutrophils isolated from the peripheral blood
of CD4
-expressing mice demonstrated low level but specific cytolysis of Raji-env targets in a chromium release cytotoxicity assay. One representative experiment is shown in
Fig. 5. After correction of the E/T ratio for the percentage of CD4
-expressing cells in the bulk neutrophil population
(i.e., 8%), UR-mediated target cell lysis approached FcRmediated ADCC. Because of limitations in the absolute
number of CD4
-expressing neutrophils that could be isolated from these mice, and the observation that neutrophil
ADCC is optimal at E/T ratios in excess of 100:1 (37),
E/T ratios necessary for maximal killing were probably not
reached in these assays. Nevertheless, these in vitro data suggest a potential role for CD4
-expressing neutrophils in
mediating the antitumor effect observed in vivo. We are
currently using the SCID transplant model to investigate
the relative contributions of specific UR-expressing lineages such as NK cells, monocytes, and neutrophils in mediating protective tumor immunity in vivo.
Fig. 5.
CD4
-expressing neutrophils lyse Raji-env targets in vitro.
Cytotoxicity assays were performed using neutrophils isolated from
CD4
-transplanted or control mice as effectors and Raji-p or Raji-env
cells as targets. E/T ratios were corrected for the percentage of the bulk
neutrophil population expressing CD4
by FACS® analysis. FcR-mediated ADCC was measured by incubation of neutrophils with Raji-p in
the presence of polyclonal anti-human lymphocyte serum. Maximal cytolysis of Raji-env cells by CD4
-expressing neutrophils in three experiments was 10%, 9%, and 8% at corrected E/T ratios of 20:1, 30:1, and 25:1,
respectively. Background cytolysis by controls (CD4
neutrophils+Raji-p
and untransduced (ctrl) neutrophils+Raji-env) was always <1%, even at
E/T ratios as high as 400:1.
[View Larger Version of this Image (20K GIF file)]
using a retroviral gene transfer system. Multilineage expression of CD4
was documented at high levels in myeloid
and NK cells present in PB and bone marrow, and expression remained stable over 4-6 mo in vivo. 80% of CD4
transplanted mice survived after challenge with a lethal dose of a disseminated HIV-env-expressing human leukemia, and surviving animals showed no detectable evidence
of residual circulating leukemia cells by PCR analysis. The
data presented here demonstrate that CD4
-expressing effector cells are the primary mediators of the antitumor activity observed, a conclusion supported by the following
observations: (a) Infusion of Raji-p leads to rapid leukemia
dissemination and death of CD4
-expressing mice; (b) Raji-env cells injected into untransplanted control mice are
lethal; (c) mice transplanted with a poorly expressed UR
(SAb
) succumb after Raji-env challenge; and (d) failure of
CD4
-expressing mice to survive after challenge with Rajienv cells is associated with the outgrowth of env
Raji revertants in vivo.
can effectively redirect effector cells of non-T cell
lineages both in vivo and in vitro. In contrast to T cells,
FcRs function as the primary immune receptors for myeloid and NK cells. Like the TCR-
chain, the
chain of
the FcR mediates intracellular signal transduction (21).
Fc
RIIIA (found on macrophages and NK cells) and
Fc
RI (found on eosinophils, basophils, and mast cells) are
multiunit protein complexes containing cytoplasmic
-
homodimers or
-
heterodimers that function as connectors to signal transduction (18). Fc
RI (present on
monocyte/macrophages and activated neutrophils) physically associates with the homodimeric
subunit of Fc
RI,
which may act as a signaling intermediate (40, 41). The
genes for the FcR-
and TCR-
chains belong to the same
gene family and share a 34% sequence homology at the amino acid level (17). The cytoplasmic tails of
and
share a conserved 18-amino acid immunoreceptor tyrosine motif
that becomes phosphorylated in response to immune receptor cross-linking by associated tyrosine protein kinases.
Subsequent activation of signal transduction pathways results in effector functions such as cytolysis, phagocytosis,
and mediator release (18, 42). Although
is functionally associated with
in a subset of FcRs, and structural similarity
exists between these two chains, URs containing the cytoplasmic domain of
rather than
may exhibit enhanced or
differential function in myeloid and NK cells. It will, therefore, be of interest in future studies to compare the relative
activity of
- and
-based URs in this SCID model.
(37), and macrophage antitumor ADCC is
enhanced by M-CSF, GM-CSF, and IL-3 (45). In the
SCID transplant model, the CD4
UR is presumably functioning via the FcR-signaling pathway to activate cytotoxic
mechanisms of myeloid and/or NK cells in vivo. It will be
of interest to determine whether UR-mediated effector
function may be enhanced by in vivo exposure of transplanted mice to cytokines such as G-CSF or GM-CSF. In
this model, leukemia cells are injected intravascularly into
the same compartment as the gene-modified effector cells,
thereby providing optimal exposure of effectors to tumor.
One of the next challenges will be the development of new
animal models that permit evaluation of the UR stem cell
gene therapy approach in the treatment of established solid
tumors.
Address correspondence to Dr. Margo R. Roberts, Director, Immunology and Cell Biology, Cell Genesys Inc., Foster City, CA 94404.
Received for publication 28 August 1996
K.M. Hege was supported in part by the department of Hematology/Oncology, University of California, San Franciso School of Medicine.The authors thank D. Casentini, L. Feng, and R. McGuinness for technical assistance, and J. McCune, R. Germain, and A. Weiss for careful reading of the manuscript.
| 1. | Baltimore, D.. 1988. Intracellular immunization. Nature (Lond.). 335: 395-396 [Medline] . |
| 2. | Gilboa, E., and E. Smith. 1994. Gene therapy for infectious diseases: the AIDS model. Trends Genet. 10: 139-144 [Medline] . |
| 3. | Bridges, S.H., and N. Sarver. 1995. Gene therapy and immune restoration for HIV disease. Lancet. 345: 427-432 [Medline] . |
| 4. |
Lever, A.M..
1995.
Gene therapy for HIV infection.
Br. Med.
Bull.
51:
149-166
|
| 5. | Shirai, M., C.D. Pendleton, J. Ahlers, T. Takeshita, M. Newman, and J.A. Berzofsky. 1994. Helper-cytotoxic T lymphocyte (CTL) determinant linkage required for priming of anti-HIV CD8+ CTL in vivo with peptide vaccine constructs. J. Immunol. 152: 549-556 [Abstract] . |
| 6. | Laube, L.S., M. Burrascano, C.E. Dejesus, B.D. Howard, M.A. Johnson, W.T. Lee, A.E. Lynn, G. Peters, G.S. Ronlov, and K.S. Townsend. 1994. Cytotoxic T lympocyte and antibody responses generated in rhesus monkeys immunized with retroviral vector-transduced fibroblasts expressing human immunodeficiency type-1 IIIB ENV/REV proteins. Hum. Gene Ther. 5: 853-862 [Medline] . |
| 7. | Tepper, R.I., and J.J. Mule. 1994. Experimental and clinical studies of cytokine gene-modified tumor cells. Hum. Gene Ther. 5: 153-164 [Medline] . |
| 8. |
Culver, K.W.,
T.M. Vickers,
J.L. Lamsam, and
T. Walling.
1995.
Gene therapy for solid tumors.
Br. Med. Bull.
51:
192-204
|
| 9. |
Irving, B.A., and
A. Weiss.
1991.
The cytoplasmic domain of
the T cell receptor chain is sufficient to couple to receptorassociated signal transduction pathways.
Cell.
64:
891-901
[Medline]
.
|
| 10. | Romeo, C., and B. Seed. 1991. Cellular immunity to HIV activated by CD4 fused to T cell or Fc receptor polypeptides. Cell. 64: 1037-1046 [Medline] . |
| 11. |
Letourneur, F., and
R.D. Klausner.
1991.
T-cell and basophil
activation through the cytoplasmic tail of T-cell receptor family proteins.
Proc. Natl. Acad. Sci. USA.
88:
8905-8909
|
| 12. |
Hwu, P.,
G.E. Shafer,
J. Treisman,
D.G. Schindler,
G. Gross,
R. Cowher,
S.A. Rosenberg, and
Z. Eshhar.
1993.
Lysis of
ovarian cancer cells by human lymphocytes redirected with a
chimeric gene composed of an antibody variable region and
the Fc receptor chain.
J. Exp. Med.
178:
361-366
|
| 13. |
Roberts, M.R.,
L. Qin,
D. Zhang,
D.H. Smith,
A. Tran,
T.J. Dull,
J.E. Groopman,
D.J. Capon,
R.A. Byrn, and
M.H. Finer.
1994.
Targeting of human immunodeficiency virusinfected cells by CD8+ T lymphocytes armed with universal
T-cell receptors.
Blood.
84:
2878-2889
|
| 14. |
Tran, A.-C.,
D. Zhang,
R. Byrn, and
M.R. Roberts.
1994.
Chimeric -receptors direct human natural killer effector
function to permit killing of NK-resistant tumor cells and
HIV-infected T lymphocytes.
J. Immunol.
155:
1000-1009
[Abstract]
.
|
| 15. | Sussman, J.J., J.S. Bonifacino, J. Lippincott-Schwartz, A.M. Weissman, T. Saito, R.D. Klausner, and J.D. Ashwell. 1988. Failure to synthesize the T cell CD3-zeta chain: structure and function of a partial T cell receptor complex. Cell. 52: 85-95 [Medline] . |
| 16. |
Frank, S.J.,
B.B. Niklinska,
D.G. Orloff,
M. Mercep,
J.D. Ashwell, and
R.D. Klausner.
1990.
Structural mutations of
the T cell receptor zeta chain and its role in T cell activation.
Science (Wash. DC).
249:
174-177
|
| 17. |
Kuster, H.,
H. Thompson, and
J.-P. Kinet.
1990.
Characterization and expression of the gene for the human Fc receptor
subunit.
J. Biol. Chem.
265:
6448-6452
|
| 18. |
Kinet, J.-P..
1992.
The - dimers of Fc receptors as connectors to signal transduction.
Curr. Opin. Immunol.
4:
43-48
[Medline]
.
|
| 19. |
Letourneur, O.,
I.C.S. Kennedy,
A.T. Brini,
J.R. Ortaldo,
J.J. O'Shea, and
J.-P. Kinet.
1991.
Characterization of the
family of dimers associated with Fc receptors (Fc RI and
Fc RIII).
J. Immunol.
147:
2652-2656
|
| 20. | Vivier, E., M. Ackerly, N. Rochet, and P. Anderson. 1992. Structure and function of the CD16: : complex expressed
on human natural-killer cells. Int. J. Cancer(Suppl.)7:11-14.
|
| 21. |
Wirthmueller, U.,
T. Kurosaki,
M.S. Murakami, and
J.V. Ravetch.
1992.
Signal transduction by Fc gamma RIII (CD16)
is mediated through the gamma chain.
J. Exp. Med.
175:
1381-1390
|
| 22. | Bosma, G.C., R.P. Custer, and M.J. Bosma. 1983. A severe combined immunodeficiency mutation in the mouse. Nature (Lond.). 301: 527-530 [Medline] . |
| 23. | Bosma, M.J., and A.M. Carroll. 1991. The SCID mouse mutant: definition, characterization, and potential uses. Annu. Rev. Immunol. 9: 325-350 . |
| 24. |
Finer, M.H.,
T.J. Dull,
L. Qin,
D. Farson, and
M.R. Roberts.
1994.
kat: a high-efficiency retroviral transduction system for primary human T lymphocytes.
Blood.
83:
43-50
|
| 25. | Cavacini, L.A., C.L. Emes, J. Power, J. Underdahl, R. Goldstein, K. Mayer, and M.R. Posner. 1993. Loss of serum antibodies to a conformational epitope of HIV-1/gp120 identified by a human monoclonal antibody is associated with disease progression. J. Acquir. Immune Defic. Syndr. 6: 1093-1102 . |
| 26. | Cattan, A.R., and E. Douglas. 1993. The C.B.17 SCID mouse strain as a model for human disseminated leukaemia and myeloma in vivo. Leuk. Res. 18: 513-522 . |
| 27. | Moritz, T., V.P. Patel, and D.A. Williams. 1994. Bone marrow extracellular matrix molecules improve gene transfer into human hematopoietic cells via retroviral vectors. J. Clin. Invest. 93: 1451-1457 . |
| 28. | Ferrante, A., and Y.H. Thong. 1980. Optimal conditions for simultaneous purification of mononuclear and polymorphonuclear leucocytes from human peripheral blood by the Ficoll-Hypaque method. J. Immunol. Methods. 36: 109-117 [Medline] . |
| 29. |
Lim, B.,
D.A. Williams, and
S.H. Orkin.
1987.
Retrovirusmediated gene transfer of human adenosine deaminase: expression of functional enzyme in murine hematopoietic stem
cells in vivo.
Mol. Cell. Biol.
7:
3459-3465
|
| 30. | Lerner, C., and D.E. Harrison. 1990. 5-Fluorouracil spares hematopoietic stem cells responsible for long-term repopulation. Exp. Hematol. 18: 114-118 [Medline] . |
| 31. |
Ho, M., and
T.A. Springer.
1983.
Tissue distribution, structural characterization, and biosynthesis of Mac-3, a macrophage
surface glycoprotein exhibiting molecular weight heterogeneity.
J. Biol. Chem.
258:
636-642
|
| 32. | Spangrude, G.J., S. Heimfeld, and I.L. Weissman. 1991. Purification and characterization of mouse hematopoietic stem cells. Science (Wash. DC). 241: 58-62 . |
| 33. |
Sentman, C.I.,
J. Hackett,
V. Kumar, and
M. Bennett.
1989.
Identification of a subset of murine natural killer cells that
mediates rejection of Hh-1b bone marrow grafts.
J. Exp.
Med.
170:
191-202
|
| 34. | Uchida, N., W.H. Fleming, E.J. Alpern, and I.L. Weissman. 1993. Heterogeneity of hematopoietic stem cells. Curr. Opin. Immunol. 5: 177-184 [Medline] . |
| 35. |
Mager, D., and
P. Henthron.
1984.
Identification of a retrovirus-like repetitive element in human DNA.
Proc. Natl.
Acad. Sci. USA.
81:
7510-7514
|
| 36. |
Brodsky, I..
1993.
Expression of HERV-K proviruses in human leukocytes.
Blood.
81:
2369-2374
|
| 37. | Baldwin, G.C., G.Y. Chung, C. Kaslander, T. Esmail, R.A. Reisfeld, and D.W. Golde. 1993. Colony-stimulating factor enhancement of myeloid cell cytotoxicity towards neuroectodermal tumour cells. Br. J. Haematol. 83: 545-553 [Medline] . |
| 38. |
Valerius, T.,
R. Repp,
T.P.M. de Wit,
S. Berthold,
E. Platzer,
J.R. Kalden,
M. Gramatzki, and
J.G.J. van de Winkel.
1993.
Involvement of the high affinity receptor for IgG (Fc RI;
CD64) in enhanced tumor cell cytotoxicity of neutrophils
during granulocyte colony-stimulating factor therapy.
Blood.
82:
931-939
|
| 39. |
Reali, E.,
A.L. Guiliani,
S. Spisani,
S. Moretti,
R. Gavioli,
G. Masucci,
R. Gambari, and
S. Traniello.
1994.
Interferon-
enhances monoclonal antibody 17-1A-dependent neutrophil
cytotoxicity toward colorectal carcinoma cell line SW11-16.
Clin. Immunol. Immunopathol.
71:
105-112
[Medline]
.
|
| 40. |
Ernst, L.K.,
J.F. Van der Winkle,
I.M. Chiu, and
C.L. Anderson.
1992.
Three genes for the human high affinity Fc
receptor for IgG (Fc RI) encode four distinct transcription
products.
J. Biol. Chem.
267:
15692-15700
|
| 41. |
Scholl, P.R., and
R.S. Geha.
1993.
Physical association between the high affinity IgG receptor (Fc gamma RI) and the
gamma subunit of the high affinity IgE receptor (Fc epsilon
RI gamma).
Proc. Natl. Acad. Sci. USA.
90:
8847-8850
|
| 42. |
Paolini, R.,
V. Renard,
E. Vivier,
K. Ochiai,
M.H. Jouvin,
B. Malissen, and
J.P. Kinet.
1995.
Different roles for the Fc
epsilon RI gamma chain as a function of the receptor context.
J. Exp. Med.
181:
247-255
|
| 43. | Jewett, A., J.V. Giorgi, and B. Bonavida. 1990. Antibodydependent cellular cytotoxicity against HIV-coated target cells by peripheral blood monocytes from HIV seropositive asymptomatic patients. J. Immunol. 145: 4065-4071 [Abstract] . |
| 44. | Szelc, C.M., C. Mitcheltree, R.L. Roberts, and E.R. Stiehm. 1992. Deficient polymorphonuclear cell and mononuclear cell antibody-dependent cellular cytotoxicity in pediatric and adult human immunodeficiency virus infection. J. Infect. Dis. 166: 486-493 [Medline] . |
| 45. | Mufson, R.A., J. Aghajanian, G. Wong, C. Woodhouse, and A.C. Morgan. 1989. Macrophage colony-stimulating factor enhances monocyte and macrophage antibody-dependent cell-mediated cytotoxicity. Cell. Immunol. 119: 182-192 [Medline] . |
| 46. | Young, D.A., L.D. Lowe, and S.C. Clark. 1990. Comparison of the effects of IL-3, granulocyte-macrophage colony-stimulating factor, and macrophage colony-stimulating factor in supporting monocyte differentiation in culture. J. Immunol. 145: 607-615 [Abstract] . |
| 47. | Ragnhammar, P., J.E. Frodin, P.P. Trotta, and H. Mellstedt. 1994. Cytotoxicity of white blood cells activated by granulocyte-colony-stimulating factor, granulocyte/macrophage-colony-stimulating factor, and macrophage-colonystimulating factor against tumor cells in the presence of various monoclonal antibodies. Cancer Immunol. Immunother. 39: 254-262 [Medline] . |
| 48. |
Bonnema, J.D.,
L.M. Karnitz,
R.A. Schoon,
R.T. Abraham, and
P.J. Leibson.
1994.
Fc receptor stimulation of phosphatidylinositol 3-kinase in natural killer cells is associated with
protein kinase C-independent granule release and cell-mediated cytotoxicity.
J. Exp. Med.
180:
1427-1435
|
| 49. |
Brenner, M.K.,
J.M. Cunningham,
B.P. Sorrentino, and
H.E. Heslop.
1995.
Gene transfer into hemopoietic progenitor cells.
Br. Med. Bull.
51:
167-191
|
| 50. |
Yu, M.,
M.C. Leavitt,
M. Maruyama,
O. Yamada,
D. Young,
A.D. Ho, and
F. Wong-Staal.
1995.
Intracellular immunization of human fetal cord blood stem/progenitor cells
with a ribozyme against human immunodeficiency virus type
1.
Proc. Natl. Acad. Sci. USA.
92:
699-703
|
| 51. | Murphy, W.J., S.K. Durum, M.R. Anver, D.K. Ferris, D.W. McVicar, J.J. O'Shea, S.K. Ruscetti, M.R. Smith, H.A. Young, and D.L. Longo. 1994. Induction of T cell differentiation and lymphomagenesis in the thymus of mice with severe combined immune deficiency (SCID). J. Immunol. 153: 1004-1014 [Abstract] . |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|